RegulonDB RegulonDB 10.8: Gene Sequence
evgA gene sequence


Size: 615        A: 201  T: 168  G: 127  C: 119

Fasta

 

>evgA E. coli K12. Version NC_000913.3 GI:556503834
atgaacgcaataattattgatgaccatcctcttgctatcgcagcaattcgtaatttattg
atcaaaaacgatattgaaatcttagcagagttgactgaaggcggaagtgccgttcagcgg
gtggaaacacttaagcctgatatcgtcatcattgatgtcgatatccccggagttaacggt
atccaggtgttagaaacgctgaggaagcgccaatatagcggaattattattatcgtctcc
gctaaaaatgaccatttttacgggaaacattgtgctgatgctggcgctaatggtttcgtg
agtaaaaaagaaggcatgaacaatatcattgcggctattgaagctgcaaaaaatggctac
tgctatttccccttctctctcaaccggtttgttggaagtttaacgtccgaccagcaaaaa
ctcgactccttatcgaaacaagaaattagtgtcatgcggtatattcttgatggcaaggat
aataatgacattgctgaaaaaatgttcatcagcaacaaaactgtcagcacttataaaagt
cgcctgatggaaaaattagaatgtaaatcactgatggatctttacacattcgcacaacgt
aacaaaatcggctaa
              
                            

Download fasta file
RegulonDB