RegulonDB RegulonDB 10.8: Gene Sequence
evgS gene sequence


Size: 3594        A: 1130  T: 997  G: 709  C: 758

Fasta

 

>evgS E. coli K12. Version NC_000913.3 GI:556503834
atgaagtttttaccctatatttttcttctctgttgtggtctttggtcgaccataagtttc
gcagacgaagattacatcgaatatcgtggcatcagtagtaacaaccgtgtcacacttgat
ccactacgtctgagcaacaaggaattacgttggttagcgagcaaaaaaaatcttgtgatt
gcagtacataagtcccaaacggctacgttgttgcataccgattcgcagcaacgggttcgt
ggtattaatgctgattatttaaatcttttaaaaagagcgttaaatatcaaattaacactc
cgggaatacgcagatcatcaaaaagcaatggacgcgcttgcagaaggtgaagtcgatata
gtgttatcacatttagttacttcgccgcctcttaataatgacattgctgcaaccaaacca
ttgataattacctttccggcgctggtaaccacccttcacgactcaatgcgaccgcttacc
tcaccaaaaccagtaaatattgctcgggtagcaaattaccccccagacgaggtaattcat
caatcatttccaaaagcaacaattatctcttttacaaatttatatcaggcattagcatcc
gtctcagctgggcacaatgattactttattggtagtaacatcattaccagcagtatgatt
tcccgctatttcactcactccttaaatgtagtgaaatattataactcgccgcgtcaatat
aattttttcttgaccagaaaagaatctgtcattcttaatgaagtactcaatagatttgtt
gatgctttaacaaatgaagttcgctatgaagtatcacaaaattggcttgatacaggaaac
ctggcctttctgaacaaaccattagaactcactgaacatgaaaaacagtggattaagcag
catcccaatttaaaggtgctggaaaatccttactcgcccccctattctatgacggatgaa
aatggctcggttcggggcgttatgggggacattcttaatattattaccttgcaaacaggt
ttaaatttttctccgatcaccgtttcacacaatatccatgctggaacacagcttagcccc
ggaggatgggatataatacctggcgctatttatagtgaagatcgagaaaataatgtttta
tttgctgaagccttcataacaacgccttacgtttttgtcatgcaaaaagcgcctgacagt
gaacaaacattaaaaaaaggaatgaaagttgccattccatattattatgagctgcattcg
caattaaaagagatgtatccggaggttgaatggatacaggtcgataatgccagcgctgca
tttcacaaggttaaggaaggtgaacttgatgctctggtcgcgacacagctaaattcgcgt
tacatgatcgatcattactatcctaatgaactttatcattttcttattcctggcgttccg
aatgcatcgctttcgttcgcttttcctcgcggagaaccggaacttaaggatattattaat
aaagcactgaatgcaattcccccaagcgaagttctgcgcctgacggaaaaatggattaaa
atgcccaatgtgaccattgacacatgggacctatatagcgagcaattttatattgttacg
acattatccgttttattagttggcagtagccttttatggggattctacctgttacgctca
gttcgtcgtcgtaaagtcattcagggtgatttagaaaaccaaatatcattccgaaaagca
ctctcggattccttaccgaatccaacttatgttgtaaactggcaaggtaatgtcattagt
cataatagtgcttttgaacattatttcactgcggattactacaaaaatgcaatgttacca
ttagaaaacagtgactcaccctttaaagatgttttttctaatgcgcatgaagtcacagca
gaaacgaaagaaaatcgaacaatatacacacaggtatttgaaattgataatggcatcgag
aaaagatgcattaatcactggcatacattatgcaatcttcctgcaagtgacaatgcagta
tatatttgtggttggcaagatattactgaaacgcgtgatctaattaatgcactcgaggta
gaaaaaaataaagcgataaaggctaccgtagcaaaaagtcagtttctggcaacgatgagt
cacgaaataagaacaccaataagctctattatgggcttcctggaacttctgtcgggttct
ggtcttagcaaggagcaacgggtggaggcgatttcacttgcctacgccaccggacaatca
ctcctcggcttaattggtgaaatccttgatgtcgacaaaattgaatcgggtaactatcaa
cttcaaccacaatgggtcgatatccctactttagtccagaacacttgtcactctttcggt
gcgattgctgcaagcaaatcgatcgcattaagttgcagcagtacgtttcctgaacattac
ctggttaagatcgaccctcaggcgtttaagcaggtcttatcaaatttactgagtaatgct
ctcaaatttaccaccgagggggcagtaaaaattacgacctccctgggtcacattgatgac
aaccacgctgttatcaaaatgacgattatggattctggaagtggattatcgcaggaagaa
caacaacaactgtttaaacgctacagccaaacaagtgcaggtcgtcagcaaacaggttct
ggtttaggcttaatgatctgcaaagaattaattaaaaatatgcagggcgatttgtcatta
gaaagtcatccaggcataggaacaacatttacgatcacaatcccggtagaaattagccag
caagtggcgactgtcgaggcaaaagcagaacaacccatcacactacctgaaaagttgagc
atattaatcgcggatgatcatccgaccaacaggctattactcaaacgccagctaaatcta
ttaggatatgatgttgatgaagccactgatggtgtgcaagcgctacacaaagtcagtatg
caacattatgatctgcttattactgacgttaatatgccgaatatggatggttttgagttg
actcgcaaactccgtgagcaaaattcttccttacccatctgggggcttacagccaacgca
caggctaacgaacgtgaaaaagggttaagttgcggcatgaacttatgtttgttcaaaccg
ttgaccctggatgtactgaaaacacatttaagtcagttacaccaagttgcgcatattgca
cctcagtatcgccaccttgatatcgaagccctgaaaaataatacggcgaacgatctacaa
ctgatgcaggagattctcatgactttccagcatgaaacgcataaagatctacccgctgcg
tttcaagcactagaagctggcgataacagaactttccatcagtgtattcatcgcatccac
ggtgcggctaacatcctgaatttgcaaaagttgattaatattagccatcagttagaaata
acacctgtttcagatgacagtaagcctgaaattcttcagttgctgaactctgtaaaagaa
cacattgcagagctggaccaggagattgctgttttctgtcagaaaaatgactaa
              
                            

Download fasta file
RegulonDB