RegulonDB RegulonDB 10.9: Gene Sequence
proP gene sequence


Size: 1503        A: 310  T: 435  G: 418  C: 340

Fasta

 

>proP E. coli K12. Version NC_000913.3 GI:556503834
atgctgaaaaggaaaaaagtaaaaccgattacccttcgtgatgtcaccattattgatgac
ggtaaactgcgtaaagccattaccgcagcatcactgggtaatgcaatggaatggttcgat
tttggtgtttatggttttgttgcttacgcattaggtaaagtttttttcccgggggctgac
cccagcgtgcagatggttgctgcacttgccactttctccgttccctttctgattcgaccg
cttggcggactcttctttggtatgttgggcgataaatatggtcgccagaagatcctcgct
atcactattgtgattatgtcgatcagtacgttctgtattggcttaataccgtcctacgac
acgattggtatttgggcaccgattctgctgttgatctgtaagatggcacaaggtttctcg
gtcggcggtgaatataccggggcgtcgatatttgttgcggaatactcccctgaccgtaaa
cgtggctttatgggcagctggctggacttcggttctattgccgggtttgtgctgggtgcg
ggcgtggtggtgttaatttcgaccattgtcggcgaagcgaacttcctcgattggggctgg
cgtattccgttctttatcgctctgccgttagggattatcgggctttacctgcgccatgcg
ctggaagagactccggcgttccagcagcatgtcgataaactggaacagggcgaccgtgaa
ggtttgcaggatggcccgaaagtctcgtttaaagagattgccactaaatactggcgcagc
ctgttgacatgtattggtctggtaattgccaccaacgtgacttactacatgttgctgacc
tatatgccgagttatttgtcgcataacctgcattactccgaagaccacggggtgctgatt
attatcgccattatgatcggtatgctgtttgtccagccggtgatgggcttgctgagtgac
cgttttggccgtcgtccgtttgtgctacttggtagtgttgccctgtttgtgttggcgatc
ccggcgtttattctgattaacagtaacgtcatcggcctgatttttgccgggttactgatg
ctggcggtgatccttaactgctttacgggcgttatggcttctaccttgccagcgatgttc
ccgacgcatatccgttacagcgcgctggcggcggcatttaatatttcggtgctggttgcc
ggtctgacgccaacgctggcggcctggctggtcgaaagctcgcagaatctgatgatgcct
gcctattacctgatggtagtggcggtggttggtttaatcaccggcgtaaccatgaaagag
acggcaaatcgtccgttgaaaggtgcgacaccggcggcgtcagatatacaggaagcgaag
gaaattctcgtcgagcattacgataatatcgagcagaaaatcgatgatattgaccacgag
attgccgatttgcaggcgaaacgtacccgcctggtgcagcaacatccgcgaattgatgaa
taa
              
                            

Download fasta file
RegulonDB