RegulonDB RegulonDB 10.9: Gene Sequence
basS gene sequence


Size: 1092        A: 262  T: 238  G: 307  C: 285

Fasta

 

>basS E. coli K12. Version NC_000913.3 GI:556503834
atgcattttctgcgccgaccaatatcgctgcgccaacggctgatattgaccatcggggcc
attttgttggtgtttgagctgatcagcgtcttctggctatggcatgaaagtaccgagcag
attcagctgtttgagcaggcgctacgcgacaatcgcaacaacgatcgccacatcatgcgt
gagatccgcgaggcggtcgccagcctgattgtccccggcgtctttatggtcagcctgacg
ctatttatctgctatcaggcggtacgccgcatcacccgcccgctggcggagctgcaaaaa
gagctggaagcgcgcaccgccgacaacttaacgcccattgccattcacagcgccaccctc
gaaatcgaagcggtggtttcggcgttaaacgatctggtcagtcgcctgaccagcacgctg
gataacgaaaggttgtttaccgctgacgtcgcgcacgaactgcgaacgccactggcgggg
gtgcgtttgcatctggaactgctggcgaaaacgcatcacattgatgtagcaccgttagtg
gcacggcttgatcagatgatggagagcgtctcccagctgctgcaactggcgcgtgccgga
cagtcattttcttccggtaattatcaacatgtaaaactgctggaagatgtcattctcccc
tcgtatgacgaactcagtaccatgctcgaccagcgacagcaaaccctgctattgccagag
agcgccgccgacatcaccgttcagggtgatgcaaccctgctgcggatgttattgcgaaac
ctggtagaaaacgcccatcgttacagcccgcaaggcagcaacattatgattaagctgcaa
gaagatgacggagcggtcatggcagttgaagatgaaggaccaggtattgatgagagtaaa
tgcggggagttgagtaaagcgtttgtacgtatggacagccgttatggcgggattggtctg
gggttaagtattgtcagccgcattacacagttgcatcacgggcagtttttcctgcaaaac
cggcaagagacttccggcacgcgggcctgggtacggctgaagaaagatcagtacgtggca
aaccagatataa
              
                            

Download fasta file
RegulonDB