RegulonDB RegulonDB 10.9: Gene Sequence
basR gene sequence


Size: 669        A: 169  T: 144  G: 188  C: 168

Fasta

 

>basR E. coli K12. Version NC_000913.3 GI:556503834
atgaaaattctgattgttgaagacgatacgctgttattgcagggactgattctggcggcg
caaaccgaaggctacgcgtgcgatagcgtgacaaccgcgcggatggcggaacaaagcctt
gaggcaggtcattacagcctggtggtactggatttagggttacccgacgaagatggactg
cattttctcgcccgtatccggcagaaaaaatataccctgccggtactgatcctcaccgct
cgcgatacgctgaccgacaaaatcgccgggctggatgtcggtgccgacgactatctggtg
aagccttttgcgctggaagagttacatgcccgtatccgcgccctgctacgacgccataat
aatcagggcgaaagtgagctgattgttggcaatctgacgctgaacatgggtcgccgtcag
gtatggatgggcggtgaagagttgattctgacgcccaaagaatatgctctgctgtcacgg
ttaatgctcaaagcaggcagtccggtgcatcgggaaattctctacaacgacatctataac
tgggacaatgaaccctcgaccaacaccctggaagtgcatatccacaatctgcgcgacaaa
gtgggcaaagcccgtatccgcaccgtgcgcggctttggctatatgctggtcgcgaatgag
gaaaactaa
              
                            

Download fasta file
RegulonDB