RegulonDB RegulonDB 10.8: Gene Sequence
mfd gene sequence


Size: 3447        A: 807  T: 752  G: 983  C: 905

Fasta

 

>mfd E. coli K12. Version NC_000913.3 GI:556503834
atgcctgaacaatatcgttatacgctgcccgtcaaagcgggtgagcagcgtctgctgggc
gagttaaccggcgcagcctgtgcaacgctggtagcggaaattgccgaacgtcacgccggt
ccggtggtactcattgcaccagatatgcaaaatgctctgcgtttgcatgatgaaatcagc
cagtttaccgatcaaatggtgatgaatctggcggactgggaaactcttccctacgacagt
ttttcgcctcatcaggacattatctcctcgcgcctttccaccctttaccagctaccgacg
atgcagcgtggcgtactgattgttccggtgaatacgcttatgcagcgcgtttgcccacac
agttttctccacggtcatgcgctggtgatgaaaaaaggtcagcgcctgtcacgagatgca
ttacgaacccaactggacagcgccggttatcgccatgttgaccaggtgatggagcacggc
gaatacgccacgcgcggcgcgttgctggatctcttcccgatggggagtgagctgccttat
cgtcttgatttctttgatgatgaaatcgacagcctgcgggtgtttgacgtcgacagccag
cgcacgctggaggaagtagaagcgatcaatctgctgcccgcgcacgaatttccgaccgat
aaagcggcaattgaactgttccgcagccagtggcgcgataccttcgaagtgaagcgcgat
ccagaacatatttaccagcaagtgagtaaaggcacattacctgccgggatcgagtactgg
cagccattgttcttcagcgaaccactgccgccgctgttcagttatttccctgccaatacc
ttgctcgtgaatactggcgatctggaaaccagtgccgaacgtttccaggctgacacgctg
gcgcgttttgagaatcgcggcgtcgatccgatgcgcccgctgttgccaccacaatcgctc
tggctgcgggtggacgagctcttctcagagctgaaaaactggccccgggtgcagctaaaa
actgaacatttaccgacaaaagccgcgaatgccaatttaggtttccagaaactgccagac
ctggccgttcaggcacaacaaaaagcgccgctggatgcgctgcgtaagttcctcgagact
ttcgacggtccggtggtgttctcggtagaaagtgaaggtcgccgtgaagcgctgggtgaa
ctgctcgcacgaattaaaattgctccgcaacgcattatgcgtcttgatgaagccagcgac
cgtgggcgttatctgatgattggcgctgccgaacatggttttgtcgatacggtgcgtaat
ctggcgctgatttgcgaaagcgatctgctcggtgaacgcgttgcccgtcgtcgtcaggat
tctcgccgcaccatcaaccccgatacactgatccgtaaccttgcggaactgcatattggt
cagccggtggtccatctggagcacggcgtcggtcgttatgccggaatgaccacgctggaa
gcgggtggcattactggcgagtatctgatgctcacctatgccaacgacgccaaactgtat
gttccggtgtcgtcactgcatctgattagccgttacgcaggtggcgcggaagaaaacgcc
ccgctgcataaacttggcggcgatgcgtggtcacgcgcgcggcagaaagcggcggaaaaa
gtgcgtgatgtggcggcggaattgctggatatctacgcgcaacgcgccgccaaagagggc
ttcgcgtttaaacacgatcgtgagcagtatcagttgttctgcgacagcttcccgtttgaa
accacgccggatcaggcgcaggccattaatgcggtacttagcgacatgtgtcagccgctg
gcaatggatcgtctggtgtgcggcgatgttggctttggtaaaacagaagtggcgatgcgc
gcagctttcctggcagtagataaccacaagcaggtggcggtgctggtgcctaccaccctt
ctcgcgcagcagcattacgacaacttccgcgaccgtttcgccaactggccggtacgtatc
gaaatgatctcccgtttccgcagcgccaaagagcagacgcaaatccttgcggaagtggcg
gaagggaaaatcgatattctgatcggtacgcacaaactgctgcaaagtgacgtcaagttt
aaagatttaggcctgctgattgtcgatgaagaacaccgcttcggggtgcgtcataaagag
cgcattaaagcgatgcgcgcgaacgtggatattctgacgcttactgcaacgccgatccca
cgtacgctgaatatggcaatgagcggaatgcgtgacctgtcgattatcgccacgccgccc
gcccgtcgtctggcagttaaaacctttgtccgtgagtatgacagcatggtggtccgggag
gcgatcctgcgtgaaattttgcgcggaggacaggtttattatctctacaatgatgtggaa
aacattcagaaagccgccgaacggctggcagaactggtgccagaagcgcggatcgccatc
ggtcacgggcagatgcgcgagcgcgaactggaacgggtgatgaatgatttccatcatcaa
cgtttcaacgtgctggtttgtacaaccattatcgaaaccgggatcgacatcccgacagcc
aacactattatcattgaacgcgcggatcacttcggtctggcgcagctgcaccagttacgc
ggtcgcgtcggacgttcgcatcatcaggcatatgcatggttgctgacaccgcatccaaaa
gcgatgactaccgatgcacaaaaacgtcttgaagcaattgcctcgctggaagatctcggg
gcaggttttgcgctggcaacgcacgatctggagattcgcggcgcgggtgaactgcttggc
gaagaacaaagcggctcaatggaaaccatcggtttctcgctgtatatggagttgctggaa
aacgccgtcgatgcactgaaagccggacgcgagccgtcgctggaagatctcaccagccag
caaacagaagtcgagctgcggatgccgtcgctattgccagatgatttcatccctgacgtg
aacacgcgtctgtcgttctacaaacgtattgccagcgccaaaacggaaaacgaactggaa
gagatcaaagtcgagcttatcgatcgcttcggcctgctgccagatccggcgcgtaccctg
ctggatattgcccgtctgcgccagcaagcgcagaaactggggatcaggaagctggaaggt
aatgagaaaggcggggtgatcgaatttgccgagaagaatcacgttaatccggcctggttg
attggtttgctgcaaaaacagccgcagcattaccgccttgatggtccgacgcgcctgaaa
tttattcaggatttgagtgagcggaaaacgcgtatcgaatgggtacgccagtttatgcgt
gaactggaagagaacgcgatcgcttaa
              
                            

Download fasta file
RegulonDB