RegulonDB RegulonDB 10.8: Gene Sequence
artI gene sequence


Size: 732        A: 209  T: 155  G: 184  C: 184

Fasta

 

>artI E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaagttctgattgccgcgttaattgcaggttttagtctttccgccacagctgcc
gaaaccattcgttttgctaccgaagcctcctatcctccgtttgaatcgattgatgcaaac
aaccagatcgttggttttgacgtcgacctggcacaagcgctgtgtaaagagattgatgca
acctgcactttctctaaccaggcgtttgacagcctgatcccaagcctgaaattccgtcgc
gtagaagccgtgatggcgggcatggatatcactccggagcgtgaaaagcaggtgctgttt
accaccccgtactatgacaactctgccctgtttgtgggtcagcaaggcaaatacaccagt
gttgatcagctgaaaggcaaaaaagtcggcgtacagaacgggacgacacaccagaaattc
attatggataagcacccggaaatcactaccgttccgtatgacagctaccagaacgcaaaa
ctggatctgcaaaacgggcgtatcgacggcgtcttcggtgacaccgcagtggtcactgag
tggctgaaagataacccgaaactggcggcggtgggcgacaaagtgaccgataaagattac
ttcggcactggcctcggcatcgcggtacgtcagggcaacactgagctgcagcagaaactc
aacactgcgctggaaaaagtgaagaaagatggcacttacgaaaccatctacaacaaatgg
ttccagaagtaa
              
                            

Download fasta file
RegulonDB