RegulonDB RegulonDB 10.8: Gene Sequence
potI gene sequence


Size: 846        A: 142  T: 241  G: 260  C: 203

Fasta

 

>potI E. coli K12. Version NC_000913.3 GI:556503834
atgaataatttaccggtagttcgttcgccctggcggattgtgattttgctgctgggcttt
acctttctctacgcgccaatgctgatgctggttatctattcgtttaacagctcgaagctg
gtgacggtgtgggccggctggtcaacgcgctggtatggtgagttattgcgcgatgacgcg
atgatgagtgcggttggtttaagtctgacaattgcggcctgtgcggcgacggcggcggcg
atcctcggaactattgcggcggtggtgctggtgcgctttggcaggtttcgcggatcaaat
ggctttgcctttatgatcaccgcgccgctggtaatgccagatgtcatcacgggcttgtcg
ctgttgttattattcgtcgcgcttgctcatgccattggctggcctgcggaccgcggtatg
ctcaccatctggctggcgcatgtcactttttgtacggcttatgtggcggtcgttatttct
tcaagattgcgggaactggatcgctcgatagaagaagcagcgatggatctcggtgcgacg
ccgctgaaagtgtttttcgtcattacgctaccgatgatcatgcccgcgatcatttctggc
tggttactggcttttactttgtcgcttgatgatctggtgatcgccagctttgtttccggg
ccgggagccaccacgttaccgatgctggtcttttccagcgtgcggatgggggtgaatccg
gaaatcaacgccctggcaacattgatcctcggcgcggtcggaattgtcggatttatcgcc
tggtatctgatggctcgcgcagaaaaacagcggatacgcgacatccagcgtgcaagacgt
ggctga
              
                            

Download fasta file
RegulonDB