RegulonDB RegulonDB 10.9: Gene Sequence
dgcZ gene sequence


Size: 891        A: 239  T: 252  G: 226  C: 174

Fasta

 

>dgcZ E. coli K12. Version NC_000913.3 GI:556503834
atgatcaagaagacaacggaaattgatgccatcttgttaaatctcaataaggctatcgat
gcccactaccagtggctggtgagtatgtttcacagcgtggtcgcgagagatgccagtaag
ccagaaataacggataaccattcttatggactgtgccagtttggtcggtggattgatcat
ctggggccactcgataacgatgaattaccttacgttcggctaatggattctgcccatcaa
catatgcataactgtggtcgggaattaatgctggctattgttgaaaatcactggcaggac
gcgcatttcgacgcctttcaggaggggttgctttcttttactgcggcattaaccgattac
aaaatttatttgctgacgatccgtagcaatatggatgttttgacgggattgccgggtcgt
cgggttcttgatgaatcctttgatcatcagttacgcaacgctgagcctctgaatctttat
ttaatgttgttggatattgaccgatttaaattggttaatgatacctacgggcatttaatc
ggcgatgtagtattacgcaccctggcaacttacttagccagttggacgcgtgattacgaa
acggtttatcgctacgggggcgaagaatttatcattattgtcaaagcggctaatgatgaa
gaagcatgtcgtgcaggtgtcagaatttgccagttagtcgataaccatgccatcacacat
tctgaagggcatatcaacattaccgtgacagcaggtgtgagtcgcgcatttcctgaagag
cctctggatgtggtcattggaagagcggaccgggcaatgtatgagggtaagcaaaccgga
agaaatcgctgcatgtttattgacgaacaaaatgtgattaaccgagtttaa
              
                            

Download fasta file
RegulonDB