RegulonDB RegulonDB 10.9: Gene Sequence
atoC gene sequence


Size: 1386        A: 378  T: 329  G: 343  C: 336

Fasta

 

>atoC E. coli K12. Version NC_000913.3 GI:556503834
atgactgctattaatcgcatccttattgtggatgatgaagataatgttcgccgtatgctg
agcaccgcttttgcactacaaggattcgaaacacattgtgcgaacaacggacgcacagca
ttacacctgtttgccgatattcaccctgatgtggtgttgatggatatccgcatgccagag
atggacggcatcaaggcactaaaggagatgcgcagccatgagacccggacacccgttatt
ctgatgacggcctatgcggaagtggaaaccgccgtcgaagcgctacgctgcggagccttc
gactatgttattaaaccgtttgatctcgatgagttgaatttaatcgttcagcgcgcttta
caactccagtcaatgaaaaaagagatccgtcatctgcaccaggcactgagcaccagctgg
caatgggggcacattctcaccaacagcccggcgatgatggacatctgcaaagacaccgcc
aaaattgccctttctcaggccagcgtcttgattagcggtgaaagcggcaccgggaaagag
ttgattgccagagcgattcactacaattcgcggcgggcaaaggggccgttcattaaagtc
aactgcgcggcgctgccggaatcgttgctcgaaagtgaactgtttggtcatgaaaaaggt
gcatttactggtgcacaaaccttgcgtcagggattatttgaacgagccaacgaaggtact
ctgctcctcgacgaaattggcgaaatgccgctggtactacaagccaaattactacgcatt
ctacaggaacgggaatttgaacggattggcggccatcagaccataaaagttgatatccgc
atcattgctgccaccaaccgcgacttgcaggcaatggtaaaagaaggcaccttccgtgaa
gatctcttttatcgccttaacgttattcatttaatactgccgcctctgcgcgatcgccgg
gaagatatttccctgttagctaatcactttttgcaaaaattcagtagtgagaatcagcgc
gatattatcgacatcgatccgatggcaatgtcactgcttaccgcctggtcatggccggga
aatattcgagagctttccaacgttattgaacgcgccgtcgtgatgaattcaggcccgatc
attttttctgaggatcttccgccacagattcgtcagccagtctgtaatgctggcgaggta
aaaacagcccctgtcggtgagcgtaatttaaaagaggaaattaaacgcgtcgaaaaacgc
atcattatggaagtgctggaacaacaagaaggaaaccgaacccgcactgctttaatgctg
ggcatcagtcgccgtgcattgatgtataaactccaggaatacggtatcgatccggcggat
gtataa
              
                            

Download fasta file
RegulonDB