RegulonDB RegulonDB 11.1: Gene Sequence
nudC gene sequence


Size: 774        A: 184  T: 178  G: 228  C: 184

Fasta

 

>nudC E. coli K12. Version NC_000913.3 GI:556503834
atggatcgtataattgaaaaattagatcacggctggtgggtcgtcagccatgaacaaaaa
ttatggttgccgaagggagaattgccatatggcgaagcggcaaatttcgatcttgtgggt
cagcgcgcactacaaatcggcgaatggcagggggaacctgtttggttagtacaacagcag
cggcgtcacgatatggggtcggtacgtcaggtcattgatctcgatgttgggctgtttcaa
ctggccggacgaggcgtacaactggcggagttttaccgatcgcataaatactgtggttac
tgcgggcatgaaatgtatccgagcaaaaccgaatgggcgatgctgtgcagccattgccgt
gagcgttactacccgcaaatcgccccctgcattattgttgccatccgtcgcgatgattcg
atcctcctcgcccagcatacccgccatcgtaacggtgtccatacagtacttgccggattc
gtcgaagtgggcgaaaccctcgagcaggcagtcgcgcgggaagtgatggaagagagcgga
attaaagttaaaaacttgcgttacgtgacttctcagccgtggccgtttcctcagtcttta
atgaccgcgtttatggcggaatatgacagcggcgacatcgtgatcgacccgaaagaattg
ctcgaggcgaactggtatcgctatgacgatttgccgttactcccgccgcccggcaccgta
gcgcgccgtctgatagaagatacggtggcgatgtgtcgggcagagtatgagtga
              
                            

Download fasta file
RegulonDB