RegulonDB RegulonDB 10.10: Gene Sequence
acrA gene sequence


Size: 1194        A: 314  T: 237  G: 329  C: 314

Fasta

 

>acrA E. coli K12. Version NC_000913.3 GI:556503834
atgaacaaaaacagagggtttacgcctctggcggtcgttctgatgctctcaggcagctta
gccctaacaggatgtgacgacaaacaggcccaacaaggtggccagcagatgcccgccgtt
ggcgtagtaacagtcaaaactgaacctctgcagatcacaaccgagcttccgggtcgcacc
agtgcctaccggatcgcagaagttcgtcctcaagttagcgggattatcctgaagcgtaat
ttcaaagaaggtagcgacatcgaagcaggtgtctctctctatcagattgatcctgcgacc
tatcaggcgacatacgacagtgcgaaaggtgatctggcgaaagcccaggctgcagccaat
atcgcgcaattgacggtgaatcgttatcagaaactgctcggtactcagtacatcagtaag
caagagtacgatcaggctctggctgatgcgcaacaggcgaatgctgcggtaactgcggcg
aaagctgccgttgaaactgcgcggatcaatctggcttacaccaaagtcacctctccgatt
agcggtcgcattggtaagtcgaacgtgacggaaggcgcattggtacagaacggtcaggcg
actgcgctggcaaccgtgcagcaacttgatccgatctacgttgatgtgacccagtccagc
aacgacttcctgcgcctgaaacaggaactggcgaatggcacgctgaaacaagagaacggc
aaagccaaagtgtcactgatcaccagtgacggcattaagttcccgcaggacggtacgctg
gaattctctgacgttaccgttgatcagaccactgggtctatcaccctacgcgctatcttc
ccgaacccggatcacactctgctgccgggtatgttcgtgcgcgcacgtctggaagaaggg
cttaatccaaacgctattttagtcccgcaacagggcgtaacccgtacgccgcgtggcgat
gccaccgtactggtagttggcgcggatgacaaagtggaaacccgtccgatcgttgcaagc
caggctattggcgataagtggctggtgacagaaggtctgaaagcaggcgatcgcgtagta
ataagtgggctgcagaaagtgcgtcctggtgtccaggtaaaagcacaagaagttaccgct
gataataaccagcaagccgcaagcggtgctcagcctgaacagtccaagtcttaa
              
                            

Download fasta file
RegulonDB