RegulonDB RegulonDB 11.0: Gene Sequence
yieP gene sequence


Size: 693        A: 182  T: 169  G: 180  C: 162

Fasta

 

>yieP E. coli K12. Version NC_000913.3 GI:556503834
atgcctttaagcgcacaacagttagctgcacagaaaaacctttcgtatgttctggctgag
aagctggcgcaacggatcttaaaaggtgaatatgaacccggcaccattttgcccggtgag
attgagctgggcgagcaatttggagtgagtcgtacagcggtacgcgaagcggtcaaaacg
ttaacggcaaaagggatggttttaccgcgaccgcgaattggtactcgggtcatgccacaa
tcgaactggaattttcttgatcaggaattgcttacctggtggatgacagaagagaacttt
catcaggtcatcgatcactttctggttatgcgtatctgtctggagccgcaagcctgccta
ctggcagcaacggttggcaccgcggaacagaaagcgcatctcaatacgttaatggccgaa
atggcggcattaaaagagaactttcgccgtgaacgctggatcgaagtcgatatggcctgg
catgagcatatctatgaaatgagcgccaatccgtttttgacctcattcgcctcgctattc
cattcggtttatcacacttacttcacgtcaattaccagcgacacagtgataaagctggat
ctgcatcaggcgattgtcgatgcgattatccaaagcgatggcgacgcggcatttaaagct
tgtcaggcgctgctacgctcacctgataagtga
              
                            

Download fasta file
RegulonDB