RegulonDB RegulonDB 11.0: Gene Sequence
envR gene sequence


Size: 663        A: 204  T: 166  G: 157  C: 136

Fasta

 

>envR E. coli K12. Version NC_000913.3 GI:556503834
atggcaaaaagaaccaaagccgaagctctgaagacccggcaagaactgattgaaactgcc
atcgcccagtttgcgcagcatggcgtaagcaagacgacgctcaacgacattgccgacgcc
gctaacgttacgcgtggcgctatctactggcacttcgaaaacaagactcaactgtttaat
gagatgtggttgcaacagccttcattgcgggagttaatccaggaacacttgacggctgga
ttagagcatgacccgtttcaacaattgcgtgaaaaattgattgtcggcttgcaatatatt
gccaaaattccccgccagcaggcgttgctgaaaatcttatatcacaaatgtgaatttaat
gatgagatgctggccgagggagtgatacgcgaaaagatgggctttaatccgcagactctc
cgcgaagtattgcaggcgtgtcagcaacaaggttgtgtagcaaataacctcgatttagat
gttgtgatgattattattgatggtgccttcagcggaattgttcaaaactggttaatgaat
atggcgggttatgatctttataaacaagcccccgctctggtcgataacgtattaagaatg
ttcatgccagatgaaaacataacgaaattaattcatcaaacgaatgaattaagtgtcatg
taa
              
                            

Download fasta file
RegulonDB