RegulonDB RegulonDB 10.8: Gene Sequence
nuoF gene sequence


Size: 1338        A: 313  T: 273  G: 402  C: 350

Fasta

 

>nuoF E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaacattatccgtactcccgaaacgcatccgctgacctggcgtctgcgcgatgac
aaacagccagtgtggctggacgaataccgcagcaaaaacggttacgaaggcgcgcgtaag
gcgctgaccgggctgtctccggacgaaatcgttaatcaggtaaaagacgctggtctgaaa
gggcgcggcggcgcgggcttctcgactggcctgaaatggagcctgatgccgaaagacgaa
tccatgaacatccgttacctgctgtgtaatgccgatgaaatggagccgggcacctataaa
gaccgcctgttgatggagcaactgccgcacctgctggtggaaggtatgctcatctccgcg
tttgcgctgaaagcttaccgtggctacatcttcctgcgtggcgaatatatcgaagcggca
gttaatctgcgccgtgccattgccgaagccaccgaagcgggtctgcttggcaaaaacatt
atgggaacaggtttcgatttcgaactgttcgtccataccggggcagggcgctacatctgc
ggggaagaaacagcgttaatcaactccctggaaggacgtcgtgctaacccacgctcgaag
ccacccttcccggcaacctccggcgcatggggtaaaccgacctgtgtcaacaacgtcgaa
accctgtgtaacgttccggcgatcctcgctaacggcgtggagtggtatcagaacatctcg
aaaagtaaagatgctggcaccaagctgatgggcttctccggtcgggtgaaaaatccggga
ctgtgggaactgccgttcggcaccaccgcacgcgagatcctcgaagattacgccggtggt
atgcgtgatggtctgaaatttaaagcctggcagccaggcggcgcggggactgacttcctg
accgaagcgcaccttgatctgccgatggaattcgaaagtatcggtaaagcgggcagccgt
ctgggtacggcgctggcgatggcggttgaccatgagatcaacatggtgtcgctggtgcgt
aacctggaagagtttttcgcccgtgagtcctgcggctggtgtacgccgtgccgcgacggt
ctgccgtggagcgtgaaaattctgcgtgcgctggagcgtggtgaaggtcagccgggcgat
atcgaaacacttgagcaactgtgtcgattcttaggcccgggtaaaactttctgtgcccac
gcacctggtgcagtggagccgttacagagcgccatcaaatatttccgcgaagaatttgag
gcgggaatcaaacagccgttcagcaatacccatttgattaatgggattcagccgaacctg
ctgaaagagcgctggtaa
              
                            

Download fasta file
RegulonDB