RegulonDB RegulonDB 10.8: Gene Sequence
nrfA gene sequence


Size: 1437        A: 401  T: 285  G: 375  C: 376

Fasta

 

>nrfA E. coli K12. Version NC_000913.3 GI:556503834
atgacaaggataaaaataaacgcacgccgtatcttcagcttattgattccttttttcttt
ttcacttctgttcacgctgaacaaacggctgctcccgcaaaacctgtaactgtggaagcg
aagaatgaaacctttgccccgcagcatcccgatcaatatctctcctggaaagccacctcg
gaacagtcagagcgtgttgacgccctggcggaagatccacggctggtgatcctgtgggcg
gggtatcccttctcgcgcgattacaacaagccgcgtggacatgcttttgctgtgaccgat
gtgcgtgaaaccctgcgtaccggtgcgccgaaaaacgctgaagatggtccgctaccgatg
gcatgctggagttgtaaaagcccggatgtggcgcgtctgatccagaaagacggcgaagat
ggctacttccacggtaaatgggcgcgcggcggtccggaaatcgtcaacaacttaggttgt
gccgattgccataacaccgcctctccagagttcgccaaaggcaaaccggagttaaccctt
tcccgtccgtatgcggctcgcgcgatggaagccattggtaaaccttttgagaaagccgga
cgtttcgaccagcaatcgatggtttgcggtcagtgccatgtggagtattacttcgacggc
aaaaacaaagcggttaaattcccgtgggatgacggcatgaaagtcgaaaatatggagcag
tattacgacaaaattgccttctctgactggactaactccctgtcgaaaacgccaatgctg
aaagcgcagcacccggaatatgaaacctggacagcgggcattcacggtaaaaacaacgtg
acctgtatcgactgccatatgccaaaagtgcagaacgccgaaggcaaactctacaccgac
cataaaattggtaatccgtttgataacttcgcccagacttgtgcgaactgccatacccag
gacaaagctgccttgcaaaaagtggtcgcggaacgtaagcagtcgattaacgacctgaaa
atcaaggttgaagatcaactggttcacgctcacttcgaagcgaaagcagcgctggatgca
ggcgcgacggaagctgaaatgaagccaattcaggacgatatccgtcatgcccagtggcgc
tgggatctggcgatcgcttcccacggcattcatatgcacgcaccggaagaaggtttacgg
atgctcggtacggcgatggataaagcggcggatgcacgcaccaaactggcgcgcctgctg
gcgaccaaaggcatcacccatgaaatccagatcccggatatctcaaccaaagagaaagcc
cagcaggccattggcctgaacatggaacaaatcaaggccgagaagcaggacttcatcaaa
acggtgatcccgcagtgggaagaacaggcacgtaaaaacggtctgttaagccaataa
              
                            

Download fasta file
RegulonDB