RegulonDB RegulonDB 10.8: Gene Sequence
yfiE gene sequence


Size: 882        A: 212  T: 232  G: 251  C: 187

Fasta

 

>yfiE E. coli K12. Version NC_000913.3 GI:556503834
atggatctgcgccgttttattacgcttaaaaccgtggtggaagagggttcctttttgcga
gcttcgcaaaaattgtgctgtacacaatcgacggtgacttttcatattcagcagcttgag
caggagttttcagtccagttatttgagaaaattggccgacggatgtgccttacccgcgaa
ggaaaaaagttgctgccgcacatttatgaacttacccgagtgatggatacgcttcgtgag
gctgccaaaaaggagtcagatccggacggggaactacgcgttgtttcgggcgaaacgttg
ctctcttaccgaatgccgcaggtgttgcagcgttttcggcaacgcgccccaaaagtgcgt
ttatcgttgcagtcgctgaactgttacgtgatccgtgatgcgctactgaatgatgaggcc
gatgttggcgtcttttatcgtgtagggaatgatgatgctctgaatcgacgagagttgggt
gaacaatcactggtgctggtggcttcaccgcaaattgcagatgtcgattttactgagccg
ggaagacataacgcctgtagctttattatcaacgaaccgcaatgtgtcttccggcagata
tttgagagcacgctgcgtcagcggcggatcacggtggaaaacaccattgagcttataagt
atcgaaagcatcaagcgttgtgtcgcggcgaatatcggggtcagctacctaccgcgcttt
gcggtggcaaaagagttggagtgcggagaattaattgaattgccttttggcgaacagtcg
cagaccattacggccatgtgcgcacatcatgctggaaaagcggttagcccggcgatgcac
acttttattcagtgtgttgaagagagttttgtggctggataa
              
                            

Download fasta file
RegulonDB