RegulonDB RegulonDB 10.9: Gene Sequence
torC gene sequence


Size: 1173        A: 322  T: 250  G: 313  C: 288

Fasta

 

>torC E. coli K12. Version NC_000913.3 GI:556503834
atgcggaaactctggaacgcgctacgccgacccagtgctcgttggtcggtactggcgctg
gtcgcaattgggattgtgattggcattgcgctgattgtattgccacacgttgggatcaaa
gtcaccagcacaaccgaattttgtgtcagttgccacagtatgcaaccggtgtatgaagaa
tataaacagtcggtgcatttccagaacgcctccggcgtgcgagctgaatgccatgactgt
catatcccgccggatattccaggcatggtgaagcgcaaactggaagcgagcaatgatatc
taccagacctttattgctcactccattgatacacctgaaaaattcgaagccaaacgcgcg
gaacttgccgagcgtgaatgggcgcgaatgaaagaaaacaactcggcaacctgccgctcc
tgccataactacgatgcgatggatcatgcgaagcagcatcctgaagcagcacgtcagatg
aaggtggcagcgaaagataatcaatcctgcatcgactgtcataaaggtattgcccaccag
ttaccggatatgagtagcggcttccgtaagcagttcgatgagctgcgcgccagtgctaat
gacagtggtgacacgctgtactctattgatattaagccaatttatgcggcgaaaggcgat
aaagaagcctctggttctctgctgcctgcttcggaagtgaaagtccttaaacgtgacggc
gactggctgcaaattgaaattaccggctggacggaaagcgccggacgtcagcgtgtactc
acccaattcccaggtaaacgcatctttgttgcctcgattcgtggtgatgtgcagcagcag
gtaaaaacgctggagaaaaccaccgttgccgacaccaataccgagtggagcaagttgcag
gccactgcgtggatgaagaaaggcgacatggtgaacgatatcaaaccgatctgggcttat
gcggattcgttgtacaacggcacctgtaaccagtgccacggcgcaccggaaatcgcccac
tttgacgctaacggttggatcggcacgctcaacggcatgattggctttaccagtctcgat
aaacgtgaagaacgcaccttgttgaaatatctgcaaatgaatgcgtctgacaccgcaggt
aaggctcacggcgataagaaggaagaaaaataa
              
                            

Download fasta file
RegulonDB