RegulonDB RegulonDB 10.9: Gene Sequence
yghB gene sequence


Size: 660        A: 129  T: 194  G: 175  C: 162

Fasta

 

>yghB E. coli K12. Version NC_000913.3 GI:556503834
atggctgttattcaagatatcatcgctgcgctctggcaacacgactttgccgcgctggcg
gatcctcatattgttagcgttgtttactttgtcatgtttgccacgctgtttttagaaaac
ggcctgctgcccgcctcatttttgccaggcgacagcttgttgatactggcaggcgcattg
attgcccagggggttatggattttctgcctacgattgcgattctgaccgccgcagcaagt
ctgggctgctggctaagttatattcaggggcgctggttagggaataccaaaacggtgaaa
ggctggctggcacagcttcctgctaaatatcaccagcgcgccacctgcatgtttgaccgc
cacggtctgctggcgctgctggctggacgttttcttgcatttgtccgtacgctgctgcca
accatggcgggaatttccggtctgccaaaccgccgcttccagtttttcaactggttaagt
ggattgctgtgggtcagcgtggtaaccagttttggctatgccttaagtatgattccgttc
gttaaacgccatgaagatcaggtaatgacgttcctgatgatcctgccaattgccttgtta
accgctggcttgttaggcacgctgtttgtggtgattaaaaaaaaatactgtaacgcctga
              
                            

Download fasta file
RegulonDB