RegulonDB RegulonDB 10.9: Gene Sequence
srkA gene sequence


Size: 987        A: 242  T: 265  G: 250  C: 230

Fasta

 

>srkA E. coli K12. Version NC_000913.3 GI:556503834
atgaataacagcgcttttactttccagacactacacccggataccatcatggacgctctg
tttgagcatgggatccgggtggattccggtcttaccccgcttaacagctatgaaaaccgt
gtctatcaatttcaggacgaagatcgtcgacgttttgtcgtcaaattttatcgccctgaa
cgttggacagccgatcaaatcctcgaagaacatcaatttgcgttgcagctggtaaatgat
gaagttccggtcgcagcacctgtggcctttaacggtcagactttattgaatcatcaggga
ttttatttcgctgtttttccaagcgtcggtggtcgccagttcgaagctgataatatcgat
cagatggaagcggttgggcgttatttagggcgtatgcaccagacggggcgcaaacagctt
tttatccatcgcccgaccatcggtttgaacgaatatctcattgagccacgcaagctgttt
gaggacgctacactgataccttccgggttgaaagcggcattcctgaaagcgacagatgag
ctgattgccgccgttacagcacactggcgggaagatttcaccgttctgcggctacatgga
gactgccacgccgggaatattctctggcgcgatggtccaatgtttgttgatctggatgat
gcacgtaatggtccagccgttcaggatttgtggatgttgctcaatggcgataaagccgag
cagcggatgcaactggaaactattattgaagcttatgaagaatttagcgagttcgacacc
gctgaaatcggactgattgaacctttacgcgccatgcgtttggtttattatcttgcctgg
ctaatgcggcgttgggctgatcccgcgttcccgaaaaatttcccgtggttaaccggggaa
gattactggctgcgacagacggcgacttttatagaacaggcaaaagttctacaagaaccc
cctttgcaattaacacctatgtattaa
              
                            

Download fasta file
RegulonDB