RegulonDB RegulonDB 10.10: Gene Sequence
zapB gene sequence


Size: 246        A: 85  T: 42  G: 69  C: 50

Fasta

 

>zapB E. coli K12. Version NC_000913.3 GI:556503834
atgacaatgtcattagaagtgtttgagaaactggaagcaaaagtacagcaggcgattgat
accatcactctgttgcagatggaaatcgaagagctgaaagaaaaaaacaactcactgtcg
caggaagttcaaaatgcccagcatcagcgcgaagagctggagcgtgagaacaaccatctg
aaagaacagcagaacggctggcaggaacgtctgcaggccctgctgggtcgcatggaagag
gtctga
              
                            

Download fasta file
RegulonDB