RegulonDB RegulonDB 10.10: Gene Sequence
rraA gene sequence


Size: 486        A: 104  T: 128  G: 148  C: 106

Fasta

 

>rraA E. coli K12. Version NC_000913.3 GI:556503834
atgaaatacgatacttccgagctttgtgacatctatcaagaagatgttaacgtcgtggaa
ccgctgttctccaactttggcggacgggcgtcgtttggcggacaaataatcacggtaaaa
tgtttcgaggacaacgggttgctgtacgatctgctcgaacagaatggccgtggtcgtgtt
cttgtcgtcgatggcggtggttctgttcgtcgcgcactggtcgatgctgaactggcgcgt
ctggcagtacaaaatgaatgggaaggtctggtcatttacggcgcggtgcgtcaggtagat
gacctggaagagttggatatcggcatccaggcgatggcggcaattccggttggtgccgct
ggcgaaggcattggcgaaagcgatgtccgcgtcaattttggcggtgtcaccttcttctcc
ggcgaccatctttatgccgacaataccgggattattctttcagaagatccgctggatatt
gaatga
              
                            

Download fasta file
RegulonDB