RegulonDB RegulonDB 10.9: Gene Sequence
opgH gene sequence


Size: 2544        A: 500  T: 646  G: 738  C: 660

Fasta

 

>opgH E. coli K12. Version NC_000913.3 GI:556503834
atgaataagacaactgagtacattgacgcaatgcccatcgccgcaagcgagaaagcggca
ttgccgaagactgatatccgcgccgttcatcaggcgctggatgccgaacaccgcacctgg
gcgcgggaggatgattccccgcaaggctcggtaaaggcgcgtctggaacaagcctggcca
gattcacttgctgatggacagttaattaaagacgacgaagggcgcgatcagctgaaggcg
atgccagaagcaaaacgctcctcgatgtttcccgacccgtggcgtaccaacccggtaggc
cgtttctgggatcgcctgcgtggacgcgatgtcacgccgcgctatctggctcgtttgacc
aaagaagagcaggagagcgagcaaaagtggcgtaccgtcggtaccatccgccgttacatt
ctgttgatcctgacgctcgcgcaaactgtcgtcgcgacctggtatatgaagaccattctt
ccttatcagggttgggcgctgattaatcctatggatatggttggtcaggatttgtgggtt
tcctttatgcagcttctgccttatatgctgcaaaccggtatcctgatcctctttgcggta
ctgttctgttgggtgtccgccggattctggacggcgttaatgggcttcctgcaactgctt
attggtcgcgataaatacagtatatctgcgtcaacagttggcgatgaaccattaaacccg
gagcatcgcacggcgttgatcatgcctatctgtaacgaagacgtgaaccgtgtttttgct
ggcctgcgtgcaacgtgggaatcagtaaaagccaccgggaatgccaaacactttgatgtc
tacattcttagtgacagttataacccggatatctgcgtcgcagagcaaaaagcctggatg
gagcttatcgctgaagtcggtggcgaaggtcagattttctatcgccgccgccgtcgccgc
gtgaagcgtaaaagcggtaatatcgatgacttctgccgtcgctggggcagccagtacagc
tacatggtggtgctggatgctgactcggtaatgaccggtgattgtttgtgcgggctggtg
cgcctgatggaagccaacccgaacgccgggatcattcagtcgtcgccgaaagcgtccggt
atggatacgctgtatgcgcgctgtcagcagttcgcgacccgcgtgtatgggccactgttt
acagccggtttgcacttctggcaacttggcgagtcgcactactggggacataacgcgatt
atccgcgtgaaaccgtttatcgagcactgcgcactggctccgctgccgggcgaaggttcc
tttgccggttcaatcctgtcacatgacttcgtggaagcggcgttgatgcgccgtgcaggt
tggggggtctggattgcttacgatctcccgggttcttatgaagaattgccgcctaacttg
cttgatgagctaaaacgtgaccgccgatggtgccacggtaacctgatgaacttccgtctg
ttcctggtgaagggtatgcacccggttcaccgtgcggtgttcctgacgggcgtgatgtct
tatctctccgctccgctgtggtttatgttcctcgcgctctctactgcattgcaggtagtg
catgcgttgaccgaaccgcaatacttcctgcaaccacggcagttgttcccagtgtggccg
cagtggcgtcctgagctggcgattgcactttttgcttcgaccatggtgctgttgttcctg
ccgaagttattgagcattttgcttatctggtgcaaaggaacgaaagaatacggcggcttc
tggcgcgttacattatcgttgctgctggaagtgcttttttccgtgctgctggctccggta
cgcatgctgttccatacggtcttcgttgtcagcgcgttccttggctgggaagtggtgtgg
aattcaccgcagcgtgatgatgactccacttcctggggtgaagcgttcaaacgccacggc
tcacagctgctgttagggttagtgtgggctgttgggatggcgtggctggatctgcgtttc
ctgttctggctggcaccgattgtcttctcgttgatcctgtcaccgtttgtttcggtgatt
tccagccgtgccaccgttggtctgcgcaccaaacgctggaaactgttcctgatcccggaa
gagtattcgccgccgcaggtgctggttgataccgatcggttccttgagatgaatcgtcaa
cgctcccttgatgatggctttatgcacgcagtgtttaacccgtcatttaacgctctggca
accgcaatggcgaccgcgcgtcaccgcgccagtaaggtgctggaaatcgcccgtgaccgc
cacgttgaacaggcgctgaacgagacgccagagaagctgaatcgcgatcgtcgcctggtg
ctgctaagcgatccggtgacgatggcccgtctgcatttccgtgtctggaattccccggag
agatattcttcatgggtgagttattacgaagggataaagctcaatccactggcattgcgt
aaaccggatgcggcttcgcaataa
              
                            

Download fasta file
RegulonDB