RegulonDB RegulonDB 10.9: Gene Sequence
trxC gene sequence


Size: 420        A: 108  T: 104  G: 115  C: 93

Fasta

 

>trxC E. coli K12. Version NC_000913.3 GI:556503834
atgaataccgtttgtacccattgtcaggccatcaatcgcattcccgacgatcggatcgaa
gatgcggcaaaatgcggacgctgcggtcacgacttgtttgacggagaggtgattaatgcg
accggtgaaacactcgacaaattgctgaaggatgatctacctgtggtgatcgacttctgg
gcaccgtggtgcggcccctgccgtaatttcgcaccaatttttgaagatgtcgcgcaagag
cgtagcggtaaagtgcgctttgtgaaagtgaataccgaagctgaacgtgaattgagcagt
cgctttggaattcgtagtataccgacgatcatgattttcaaaaacggtcaggttgtcgac
atgcttaatggcgcagtaccgaaagcgccgttcgatagctggctgaacgaatctctttaa
              
                            

Download fasta file
RegulonDB