RegulonDB RegulonDB 10.9: Gene Sequence
rpoE gene sequence


Size: 576        A: 146  T: 149  G: 163  C: 118

Fasta

 

>rpoE E. coli K12. Version NC_000913.3 GI:556503834
atgagcgagcagttaacggaccaggtcctggttgaacgggtccagaagggagatcagaaa
gcctttaacttactggtagtgcgctatcagcataaagtggcgagtctggtttcccgctat
gtgccgtcgggtgatgttcccgatgtggtacaagaagcttttattaaagcctatcgtgcg
ctggattcgttccggggagatagcgctttttatacatggctgtatcggattgctgtaaat
acagcgaaaaattacctggttgctcaggggcgtcgtccaccttccagtgatgtggatgcc
attgaagctgaaaacttcgaaagtggcggcgcgttgaaagaaatttcgaaccctgagaac
ttaatgttgtcagaagaactgagacagatagttttccgaactattgagtccctcccggaa
gatttacgcatggcaataaccttgcgggagctggatggcctgagctatgaagagatagcc
gctatcatggattgtccggtaggtacggtgcgttcacgtatcttccgagcgagggaagct
attgataacaaagttcaaccgcttatcaggcgttga
              
                            

Download fasta file
RegulonDB