RegulonDB RegulonDB 11.1: Gene Sequence
yjcO gene sequence


Size: 690        A: 194  T: 153  G: 189  C: 154

Fasta

 

>yjcO E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaaattatcgcattgatgttgtttttgacattctttgcccacgccaacgactcc
gagcctggcagccagtatttaaaggcagcagaggccggggaccgacgcgcacaatatttt
cttgccgacagctggtttagctccggcgatttgagcaaagccgaatattgggcacagaaa
gccgccgacagcggtgatgctgatgcctgcgcgctgctggcgcagatcaaaatcaccaat
ccggtcagtctggactatccacaagcaaaagttcttgcagagaaagcggcgcaagcgggc
agtaaagaaggtgaagtaacgctggcgcatattctggtaaatactcaagcgggtaaaccg
gattatccaaaggcaatttcgctgttagaaaacgcctcggaagatctggagaacgactct
gccgtcgatgcccaaatgctgcttggtttgatttacgccaacggcgtgggcattaaggcc
gacgatgacaaggcaacctggtatttcaaacgcagctctgcaatttcccgaaccggttat
tccgagtactgggcgggaatgatgttcttaaacggtgaagaaggttttatcgagaagaac
aagcaaaaggcgctgcactggttgaacctgagctgtatggaagggtttgataccgggtgt
gaagagtttgaaaaattaaccaacggttaa
              
                            

Download fasta file
RegulonDB