RegulonDB RegulonDB 10.8: Gene Sequence
yehB gene sequence


Size: 2481        A: 680  T: 672  G: 654  C: 475

Fasta

 

>yehB E. coli K12. Version NC_000913.3 GI:556503834
atgttgagaatgaccccacttgcatcagcaatcgtagcgttattgctcggcattgaagct
tatgcagctgaagaaacctttgatacccattttatgataggtggaatgaaagaccagcag
gttgcaaatattcgtcttgatgataatcaacccttaccggggcagtatgacatcgatatt
tatgtcaataagcaatggcgcgggaaatatgagattattgttaaagacaacccgcaagaa
acatgtttatcaagagaagttatcaagcggttaggcattaatagcgataacttcgccagc
ggtaagcaatgtttaacatttgagcaacttgttcagggtgggagctatacctgggatatc
ggggtttttcgtctcgatttcagtgtcccgcaggcctgggtggaagaactggaaagtggc
tatgttccaccggaaaactgggagcggggtattaatgcgttttatacctcttattatctg
agtcagtattacagcgactataaagcgtcgggtaataacaagagtacatatgtacgtttt
aacagcgggttaaatttactggggtggcaactgcattctgatgccagtttcagtaaaaca
aataacaatccaggggtgtggaaaagcaataccctgtatctggaacgtggatttgcccaa
cttctcggcacgcttcgcgtgggtgatatgtacacatcaagcgatatttttgattctgtt
cgcttcagaggtgtgcggttgtttcgtgatatgcagatgttgcctaactcgaaacaaaat
tttacgccacgggtgcaggggattgctcagagtaacgcgctggtaactattgaacagaat
ggttttgtggtttatcagaaagaggttcctcctggcccgttcgcgattacagatttgcag
ttggccggtggtggagcagatcttgatgtcagcgtgaaagaggcggacggctcggtaacc
acctatctggtgccttatgcagcggtgccaaatatgctgcaacccggcgtgtcgaaatat
gatttagcggcgggtcgtagccatattgaaggggcgagcaaacaaagtgattttgtccag
gcgggttatcagtatggttttaataatttattgacgctgtatggtggctcgatggtcgcg
aataattattacgcgtttactttgggggctggctggaatacacgcattggtgccatttcc
gtcgatgccactaagtcgcatagtaaacaagacaacggcgatgtgtttgacgggcaaagt
tatcaaattgcctacaacaaatttgtgagccaaacgtcgacgcgttttggtctggcggcc
tggcgttattcgtcgcgtgattaccggacatttaacgatcacgtttgggcaaacaataaa
gataattatcgccgtgatgaaaacgatgtctatgacattgccgattattaccagaacgat
tttggccgcaaaaatagcttttccgccaatatgagccagtcattgccagaaggttggggg
tctgtgtcattaagtacgttatggcgagattactgggggcgtagcggcagtagtaaggat
tatcagttgagttattccaacaacctgcgacggataagctataccctcgcggcaagccag
gcttatgacgagaatcatcatgaagagaaacgttttaatatttttatatcgattcccttt
gattggggtgatgacgtttcgacgcctcgtcggcaaatatatatgtctaactcaacgacg
tttgatgatcaggggtttgcctcaaataatacgggattatcaggaacagtagggagtcgg
gatcagttcaattatggtgtcaacctgagtcatcaacatcagggaaatgaaacgacagct
ggggcgaatttgacctggaacgcgccggttgcgacagtgaatggcagttatagtcagtcg
agtacttatcgacaggctggagccagtgtttcagggggcattgtcgcctggtcgggtggc
gttaatctggcgaaccgtctttccgaaacgtttgctgtgatgaatgcgccaggaattaaa
gatgcttatgtcaatgggcaaaaatatcgcacaacaaaccgtaatggagtggtgatatac
gacggaatgacaccttatcgggaaaatcacctgatgctggatgtgtcgcaaagcgatagc
gaagcagaattacgtggcaaccggaaaattgccgccccttatcgcggcgcggttgtactg
gttaattttgataccgatcagcgcaagccatggtttataaaagcgttaagagcagatggg
caatcattaacgtttggttatgaagtcaatgatatccatggtcataatattggcgttgtc
ggccagggaagtcagttatttattcgcaccaatgaagtaccgccatcggttaatgtggca
attgataagcaacaaggactttcatgcacaatcaccttcggtaaagagattgatgaaagt
agaaattatatttgccagtaa
              
                            

Download fasta file
RegulonDB