RegulonDB RegulonDB 10.8: Gene Sequence
yehC gene sequence


Size: 720        A: 239  T: 198  G: 153  C: 130

Fasta

 

>yehC E. coli K12. Version NC_000913.3 GI:556503834
atggccgctatcccatggcggccttttaatttaagaggcattaaaatgaaaggattatta
tctttactcattttttctatggtccttcctgcacatgccggaattgttatctacgggacg
cgcattatttacccggcagaaaataaagaagtgatggtgcagttgatgaaccagggaaac
cgttcttcgctgctgcaggcgtggattgatgatggcgatacgtcattaccaccagaaaaa
attcaggttcctttcatgttaacgccaccagtggcaaaaataggggcaaattccgggcag
caagtaaaaatcaaaattatgccgaataaactgcccactaataaagaaagcattttttat
ctgaatgttctggatattccaccaaatagtccagagcaagaaggtaagaatgcactgaag
tttgcgatgcaaaacagaattaagttgttttaccggccagcgggtattgctccggtaaat
aaagcgacatttaaaaaattgctggtaaatcgcagtggcaatggtttggtgataaaaaat
gactcagctaattgggtgacgatttcggatgtcaaagctaataatgtcaaagtcaattat
gaaactattatgattgcccccttagaaagtcagagtgttaatgtcaaaagtaataatgca
aataactggcatctgaccattatcgatgaccatggcaactatattagtgacaaaatttaa
              
                            

Download fasta file
RegulonDB