RegulonDB RegulonDB 10.8: Gene Sequence
yehD gene sequence


Size: 543        A: 160  T: 163  G: 123  C: 97

Fasta

 

>yehD E. coli K12. Version NC_000913.3 GI:556503834
atgaaacgttcaattattgctgccgctgtcttttcttctttttttatgagcgctggagta
tttgctgcagacgttgataccggaacattaactattaaggggaatattgcagaatctccg
tgtaaattcgaagcgggtggtgattcagtaagtattaatatgccgactgtaccaaccagt
gtctttgaaggtaaagctaaatattctacctatgatgatgcagtcggtgtaaccagcagc
atgttaaaaattagctgcccgaaagaagttgctggtgtaaaactctcgttgattaccaac
gataaaataaccggtaacgataaggcgatagccagtagcaacgataccgtgggttactat
ctctatttaggtgataacagcgatgtcctggatgtttctgcaccttttaacattgagagt
tataaaacagcggaaggtcaatatgctattccgtttaaagcaaaatacctgaaactgaca
gataactcagtgcaatcaggtgatgtgttatcttctctggttatgcgtgtggcgcaggat
taa
              
                            

Download fasta file
RegulonDB