RegulonDB RegulonDB 10.8: Gene Sequence
yehQ gene sequence


Size: 1845        A: 404  T: 429  G: 518  C: 494

Fasta

 

>yehQ E. coli K12. Version NC_000913.3 GI:556503834
atgaattcactacgtccggaattattagaactgacaccgcaggccctgacggcgttaagc
aatgccggttttgttaagcgcagtcttaaggaactggaaaatggcaacgtcccggagatc
agccatgagaacgacgctttaatcgccaccttcagtgacggtgtccgtacccagctggcg
aacggccaggcactgaaagaggctcagtgcagttgcggggccaacggtatgtgccgtcat
cgcgtgatgctggtgttaagttatcaacgactttgtgccaccactcagtctacggaaaaa
gaagaagagtgggatccggcaatctggctggaagaactggctacccttcccgatgctacc
cgcaaacgcgcacaggcgctggtcgctaaaggcatcaccattgagttgttctgtgcgccg
ggtgaaattccctctgcccgcttaccgatgagcgatgtgcgtttttattcccgcagcagt
attcgtttcgcccgttgtgattgtattgaaggcacactttgcgaacatgtcgtactggcg
gtacaggccttcgtcgaggccaaagcgcagcaagcagaatttaaccatttaatctggcag
atgcgcagcgaacacgtcacatcatctgacgatccgtttgccagcgaagaaggcaacgcg
tgtcgtcaatatgttcagcaattaagccagacattatggcttggcggcatcagccagccg
ctcatccattacgaggcagcattcaaccgcgcattgcaggcggcagagacctgcaactgg
cgctgggtgagtgaatcgctacggcaactgcgcgccagcgttgatgccttccacgcccgc
gccagccactataatgccggagaatgcttacatcagcttgcggcattaaacagtcgatta
aattgcgcacaagagatggcccggcgcgacagtattggtgaagttcctcctgtgccgtgg
cgcacggtcgttggctctggcattgccggagaagcaaagcttgatcatctgcggctggtg
tctttaggtatgcgttgctggcaggatattgagcattatggtttacgcatctggtttacc
gatcccgacaccggcagtattttgcacctttcgcgcagttggccgcgaagtgaacaggaa
aactcaccggcagctacgcgtcggctgtttagttttcaggctggcgcactggcgggcggg
caaattgtttcacaagcagcaaaacgcagtgccgatggcgagctgctgttagctacccgc
aaccgcttaagcagcgttgtgccgctgtcgcctgatgcctggcaaatgttgagcgcgccg
ttacgccagccgggcattgtggctttgcgggaatatttacgccagcgtccccccgcctgc
atacggcctcttaatcaggtcgataacttatttattctgccggtcgctgagtgtatttcg
ctcggttgggacagcagccgccagacgctggatgcgcaggtcattagcggcgaaggggaa
gataatgtgctgacgttatcattaccagcctcagccagcgcaccttatgccgttgaacgc
atggcggcgcttttgcaacaaacagacgaccccgtgtgtctggtttctggctttgtcagt
tttgttgaagggcaattgacactggaaccacgggtgatgatgacaaaaacccgtgcctgg
gcgctggacgcagaaactacgcctgtggcaccgctaccttctgccagcgttttgcctgtg
ccgtctactgctcatcagttgctgatacgctgccaggcgttacttattcaactgctccat
aacggctggcgctatcaggaacagagtgctattggtcaggcatag
              
                            

Download fasta file
RegulonDB