RegulonDB RegulonDB 10.8: Gene Sequence
yejF gene sequence


Size: 1590        A: 386  T: 387  G: 411  C: 406

Fasta

 

>yejF E. coli K12. Version NC_000913.3 GI:556503834
atgacgcaaactctgttagcgattgaaaatttgtcggtgggttttcgccatcagcaaacc
gtacgtacagtagtcaatgatgtttcactacagattgaggctggcgaaacgctggcgctg
gtgggtgagtcaggttcaggcaaaagcgttaccgcgctgtcaattttacgcctgctccct
tccccgccggttgaatatctctccggcgatattcgttttcatggcgaatcgctgcttcac
gccagcgatcaaacgttgcgcggtgtacgcggtaataagatcgccatgatttttcaggaa
ccgatggtgtcgttaaatccattgcataccctggaaaaacagctttatgaagtgctttca
ctccaccgcgggatgcgtcgggaagcggctcgtggcgaaattcttaactgccttgatcgc
gttggtatccgccaggcggcaaaacggctgacagattatccgcatcagctctccggcggc
gaacggcagcgggtgatgattgcgatggcgctgttaacgcgaccggaattattaattgcc
gatgaaccgaccaccgcactggacgtctctgtccaggcgcagattttacagctgttgcgc
gaactgcaaggcgagctgaatatgggcatgctgtttattactcataacctcagcattgtc
agaaaactggcccaccgcgtggcggtaatgcaaaacggtcgctgtgtcgagcaaaattac
gccgctacgctatttgcatcacccactcatccttacacacaaaagctactcaacagtgaa
ccgtcaggcgatccagtgccgttgccagaacctgcctcaacgttgctggatgttgaacag
cttcaggttgccttccccattcgcaaagggattttgaagcgcattgtggatcataatgtg
gtggtgaaaaacatcagttttacgctacgagcgggtgaaacactgggtttagtgggcgag
tccggttccgggaaaagtacgacgggactggcgctgctgcgactgattaattctcagggc
agcatcatctttgacggtcagccactgcaaaatttaaatcgccgccagctgttacctatt
cgtcatcgcattcaggtggtatttcaggatccaaactcctcgctcaacccacgactcaac
gttttgcagattattgaggaaggcttacgggttcaccagccgacgctttctgccgcacaa
cgcgaacaacaagtgatagccgtgatgcatgaagtgggattagatcctgaaacacgccac
cgttatccggcggagttctctggtggtcagcgacaacgtattgcgattgccagggcatta
attcttaagccctcgctgatcatacttgatgaaccgacatcatcactcgacaaaacggta
caggcgcaaatattgacgctattgaaatcattgcaacaaaagcatcaactggcctatttg
tttatcagccacgatttgcacgttgtccgcgcgttatgtcatcaggttatcatactgcga
caaggggaagtagtggaacaaggaccgtgcgcgcgcgtgtttgccacaccgcagcaggag
tatacgcgtcagctactggcgttgagctga
              
                            

Download fasta file
RegulonDB