RegulonDB RegulonDB 10.10: Gene Sequence
ccmG gene sequence


Size: 558        A: 127  T: 127  G: 168  C: 136

Fasta

 

>ccmG E. coli K12. Version NC_000913.3 GI:556503834
atgaagcgcaaagtattgttaattccgttgattatcttcctggcgattgccgcggcgctg
ctgtggcagctggcgcgtaatgccgaaggggatgatccgaccaatctggaatcggcgctc
attggcaagcctgtgccgaagtttcgtctcgaatcactggacaatccggggcagttttat
caggcggatgtgctgactcagggcaaaccagtactgcttaacgtctgggcgacctggtgt
ccgacctgccgtgcggaacatcaatatctgaatcagctttctgcgcagggcatccgcgtg
gtcggcatgaactataaagacgatcgccagaaggcaatcagctggctgaaagagctgggc
aatccttacgcgctaagcctgtttgatggcgatggcatgttagggctggatctcggtgtc
tatggcgcgccagaaacgtttcttattgacggcaacggcatcattcgctatcgccatgcg
ggcgatctgaatcctcgcgtctgggaagaagagatcaagccgctgtgggagaaatacagt
aaggaggccgcacaatga
              
                            

Download fasta file
RegulonDB