RegulonDB RegulonDB 11.0: Gene Sequence
ccmC gene sequence


Size: 738        A: 132  T: 198  G: 232  C: 176

Fasta

 

>ccmC E. coli K12. Version NC_000913.3 GI:556503834
atgtggaaaacactgcatcaactggcgatcccaccacggctgtatcaaatctgtggctgg
tttataccgtggctggcaattgccagtgtggtcgtgcttaccgtcggctggatctgggga
ttcggctttgctccggctgattatcagcagggaaatagctaccgcattatctacctgcat
gtgcctgcggcgatctggtcgatgggcatttatgcatcaatggcagtggcagcgtttatt
ggccttgtctggcagatgaaaatggccaacctggcggtggcggcgatggcccccattggt
gccgtgtttacctttattgccctggttaccggctctgcatggggaaaaccgatgtggggc
acctggtgggtatgggatgcacgtctgacttctgaactggtgctgctgtttttgtatgtg
ggtgtgattgccctgtggcacgccttcgacgaccgccgtctggcgggccgtgcggcaggt
atcctggtgctgattggcgtggtgaatctgccgattattcattactccgtggagtggtgg
aacaccctgcatcagggatcaacgcggatgcagcaaagtatcgatccggcgatgcgttcg
ccgctgcgctggtcgatttttggcttcctgctcctgtctgccacgctgacgctgatgcgg
atgcgtaatttgattttgctgatggaaaaacgccgtccgtgggtgagtgaactgatactg
aaaagaggccgtaaatga
              
                            

Download fasta file
RegulonDB