RegulonDB RegulonDB 11.0: Gene Sequence
ccmB gene sequence


Size: 663        A: 107  T: 185  G: 194  C: 177

Fasta

 

>ccmB E. coli K12. Version NC_000913.3 GI:556503834
atgatgttctggcgcattttccgtcttgagctgcgtgtagcgtttcgccatagcgccgaa
atcgccaacccgctgtggttcttcctgattgtaattaccctttttccgctcagtatcggt
ccggagccgcaactgctggcgcgtattgcaccgggcattatctgggttgctgcgctgctt
tcatccttgctggcgctggaacgactgttccgtgacgatttgcaggacggcagtcttgaa
caattgatgttgttgccgttacccttgcccgccgttgtgctggcgaaggtgatggcgcac
tggatggtaaccggtctgccgttactcatcctttcgccactggtagcaatgctactggga
atggatgtttatggctggcaagtgatggcgctgacgctgctgctgggaacgcctacgctt
ggctttctcggtgcaccgggcgtggcgctgacagtgggacttaagcgcggtggtgtgctg
ctcagcatactggtgttaccgctgactatcccattactcatctttgccaccgccgcgatg
gacgcggcttctatgcatttgcccgttgacgggtatctggcaattttaggcgcgttgctg
gcaggcaccgcgacattaagtccttttgcgacggcggcagcgttacgaatcagcattcaa
taa
              
                            

Download fasta file
RegulonDB