RegulonDB RegulonDB 11.0: Gene Sequence
ccmA gene sequence


Size: 624        A: 139  T: 136  G: 184  C: 165

Fasta

 

>ccmA E. coli K12. Version NC_000913.3 GI:556503834
gtgggtatgcttgaagccagagagttactttgtgagcgggatgaacgaaccttatttagt
ggcttgtcatttacgctgaacgcaggagagtgggtacaaatcaccggtagcaacggcgcg
gggaagacaacgcttctccgtttgctgacggggttgtctcgccctgacgcaggcgaggtt
ctctggcaagggcagcccttgcatcaggtacgcgacagctaccatcaaaacctgttatgg
ataggccatcagccggggatcaaaacccggctgacggcgttagaaaatctgcacttttat
catcgcgatggcgataccgcacaatgtctggaagccctggcgcaggccgggcttgccgga
ttcgaagatattcctgtaaatcagctctcggccgggcaacaacgccgcgtcgctttagcg
cgtctgtggctgacccgtgccacgttatggatcctcgacgagccttttaccgcgattgac
gttaacggtgtcgatcgtctgacccagcgtatggcgcagcatacggagcagggggggatt
gtgattctgactacccaccagccgctcaacgttgctgaaagtaaaattcgccgcatttca
ctgacgcaaacgagggccgcatga
              
                            

Download fasta file
RegulonDB