RegulonDB RegulonDB 11.0: Gene Sequence
napB gene sequence


Size: 450        A: 110  T: 90  G: 134  C: 116

Fasta

 

>napB E. coli K12. Version NC_000913.3 GI:556503834
atgaaaagccatgacctgaagaaagcgctgtgtcaatggacggcgatgctggccctggtg
gtaagcggcgcggtttgggcggctaatggcgtcgattttagccagtcgccggaagtatcc
gggacacaggaaggggccattcggatgccaaaagagcaggatcggatgccgctgaactat
gtgaatcagccgccaatgatcccgcatagcgttgaaggttatcaggtaacgaccaatacc
aatcgctgcttgcagtgccacggtgtcgaaagctatcgcaccactggcgcgccgcgtatc
agtcctactcactttatggacagcgacggcaaagtgggcgcggaagtggctccgcgtcgt
tatttctgtctgcaatgtcacgtaccgcaggccgataccgcgccaatcgtggggaatacc
tttaccccatcaaaaggttacgggaaataa
              
                            

Download fasta file
RegulonDB