RegulonDB RegulonDB 10.10: Gene Sequence
napA gene sequence


Size: 2487        A: 590  T: 501  G: 727  C: 669

Fasta

 

>napA E. coli K12. Version NC_000913.3 GI:556503834
atgaaactcagtcgtcgtagctttatgaaagctaacgccgttgcggccgctgcggcggct
gccggtctcagcgtgccgggcgttgcccgcgccgttgttggtcagcaggaagccatcaaa
tgggataaagcgccgtgccgtttctgcggtactggttgcggcgttctggtcggaacgcag
cagggacgtgtggtggcctgtcagggcgacccggacgcaccggttaaccgtggcctgaac
tgcattaagggctatttcctgcccaaaatcatgtacggtaaagaccgtttgacgcagccg
ctgctgcgtatgaaaaacggtaaatatgacaaagaaggcgaatttaccccaatcacctgg
gatcaggccttcgatgtgatggaagagaaattcaaaaccgccctgaaagaaaaagggccg
gaatcgatcggtatgttcggttctggtcagtggactatctgggaaggttatgccgcgtcc
aagctgtttaaagcgggcttccgttcgaacaacatcgacccgaacgcgcgtcactgtatg
gcgtcggcagtagttggctttatgcgtacctttggtatggatgagccgatgggctgctat
gacgacatcgagcaggctgacgcgtttgtgctgtggggcgcaaacatggcggaaatgcac
ccgatcctctggtcgcgcatcactaaccgtcgtctctctaaccagaacgtcaccgtggcg
gtgctttctacctaccagcatcgtagcttcgagctggcggataacggcatcatctttacg
ccgcaatctgacctggtgatcctgaactacatcgccaactatatcattcaaaacaatgcg
ataaatcaggacttcttcagcaagcacgttaacctgcgcaaaggggcgacggacatcggc
tacggtttacgtccgacccatccgctggaaaaagcagcgaagaatccgggttctgacgcc
tccgaaccgatgagctttgaagattacaaagccttcgttgccgagtatacgctggaaaaa
actgccgaaatgaccggcgtgccgaaagaccagttagaacaactggcgcagctgtatgcc
gatccgaacaagaaagtcatctcctactggacgatgggcttcaaccagcatactcgtggc
gtgtgggctaacaacctggtctacaacctgcacctgctgaccggcaaaatttcccagccg
ggttgcggtccgttctccctgaccgggcaaccttctgcgtgtggtactgcgcgtgaagtg
ggcacctttgctcaccgtctgcctgcggacatggtggtgaccaacgagaaacaccgtgat
atctgcgagaagaagtggaatatcccgagcggcaccattccggcgaaaatcggtctgcac
gcggtggcacaagaccgtgcgctgaaagacggcaaactgaatgtttactggaccatgtgt
accaacaacatgcaggccgggccgaacatcaatgaagagcgtatgccgggctggcgcgat
ccgcgcaacttcatcatcgtctccgatccgtatccgacagtcagtgcgctggccgccgac
ttgatcctgccgaccgcaatgtgggtagagaaagagggcgcttacggtaacgccgaacgc
cgtactcagttctggcgtcaacaggtacaggcaccgggcgaagcgaaatcggatctctgg
cagttagtccagttctcccgccgcttcaaaactgaagaagtatggccggaagatctgctg
gcgaagaaaccggaactgcgtggcaaaacgctgtacgaagtgctgtatgccacaccggaa
gtgagcaaattcccggtatccgaactggcggaagatcagctgaacgatgaatcccgcgag
ctgggcttctatctgcaaaaagggctgttcgaagagtacgcatggtttggtcgcggtcac
ggtcacgatctggcaccgttcgatgactaccacaaagcgcgcggtctgcgctggccggtg
gtgaacggtaaagaaacgcagtggcgttacagcgaaggtaacgacccgtacgtgaaagcg
ggcgaaggctataagttctacggtaaaccggatggcaaagcggtgatcttcgcactgcca
ttcgaaccggcggcggaagcaccggatgaagagtacgacctgtggctctctaccggacgc
gttctggagcactggcacaccggcagtatgactcgccgtgtaccagaactgcaccgcgcc
ttcccggaagcggtcctgtttattcacccgctggatgcgaaagcgcgcgatctgcgccgt
ggcgacaaagtgaaagtggtttctcgccgtggcgaagtgatctcgattgttgaaacgcgc
ggtcgtaaccgtccgccacagggcctggtgtacatgccgttcttcgacgccgcacagttg
gttaacaaactgacgctggatgcgaccgatccgctctcgaaagagacggacttcaagaag
tgcgcggtcaaactggagaaggtgtaa
              
                            

Download fasta file
RegulonDB