RegulonDB RegulonDB 10.9: Gene Sequence
mqo gene sequence


Size: 1647        A: 400  T: 357  G: 488  C: 402

Fasta

 

>mqo E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaagtgactgccatgctcttctcgatggccgtggggcttaatgccgtttcgatg
gcggcaaaagcgaaagcgtccgaggagcaggaaactgatgtactgttgattggcggcggc
attatgagcgccacgttggggacctatttacgcgagctggagcctgaatggtcgatgacc
atggtggagcgcctggagggtgtcgcgcaggagagttcgaacggctggaataacgccgga
accgggcattctgcactgatggaactgaactacaccccgcaaaacgccgatggcagcatc
agtattgaaaaagcagtcgccattaacgaagcatttcagatttcccgccagttctgggcg
caccaggttgagcgcggcgtgctgcgtactccgcgttcatttatcaataccgttccgcat
atgagctttgtctggggcgaggataacgtcaatttcctgcgcgcccgttacgccgcgttg
caacaaagctcgctgtttcgcggtatgcgttactctgaagatcacgcgcagatcaaagag
tgggcaccgttagtgatggaagggcgcgatccgcaacagaaagtggcagccacgcgtacg
gaaattggtaccgatgtgaactacggcgagatcacccgccagttaattgcttccttgcag
aagaaatctaacttctcgctgcaactcagcagcgaagtccgcgccctaaagcgtaatgac
gataacacctggaccgttaccgttgccgatctgaaaaatggcactgcacagaacattcgt
gccaaatttgtctttatcggcgcgggcggtgcggcgctgaagctgttacaggaatcgggg
attccggaagcgaaagactacgccggtttcccggtgggcggacagttccttgtttcggaa
aacccggacgtggttaatcaccatctggcgaaggtttacggtaaagcatccgttggcgca
ccaccgatgtcggttccgcatatcgatacccgcgttctggacggtaaacgcgtagtgctg
tttgggccatttgccaccttctcaaccaaattcctcaaaaacggttcattgtgggatcta
atgagttccaccaccacctctaacgtgatgccgatgatgcacgtcgggctggataatttc
gatctggtgaaatatctggtgagtcaggtgatgttgagtgaagaggatcgttttgaagcg
ttgaaagagtactatccgcaggcgaaaaaagaggactggcgtttgtggcaagcggggcag
cgcgtgcagattatcaagcgtgatgccgagaaaggtggcgtactgcgtctgggtactgaa
gtcgtcagtgaccagcaaggaaccattgccgcgctcctgggggcatcgccaggggcgtca
accgccgcgccgattatgttgaatctgctggaaaaagtatttggcgatcgtgtttccagc
ccgcaatggcaggctacgttgaaagcgatcgttccgtcttatggacgcaagctgaacggt
gatgtagcggcaacagaacgcgagttgcagtacaccagcgaagtgctggggttgaactac
gacaagccgcaggcagcagatagtacgccgaaaccgcagttgaaaccgcaacccgttcaa
aaagaagtggcggatattgcgttgtaa
              
                            

Download fasta file
RegulonDB