RegulonDB RegulonDB 10.9: Gene Sequence
nikB gene sequence


Size: 945        A: 142  T: 251  G: 279  C: 273

Fasta

 

>nikB E. coli K12. Version NC_000913.3 GI:556503834
atgttgcgttacgtattacgccgctttctgctgctgatcccgatggtgctcgccgcctcg
gtgatcatttttctgatgctgcgcctcggtaccggcgacccggcgctcgattatttgcgt
ctgtctaacctgccgccgacgccggagatgctggcctctacccgcaccatgctgggactg
gatcagccgctgtacgtccagtacggcacctggttgtggaaggcgctgcatcttgacttt
ggtatctcattcgccagccaacgcccggtactggacgatatgctgaacttcctgcccgcc
acgctggaacttgcaggtgcggcgctggtattaattctgctcacttccgtaccgctcggt
atctgggcggcgcgccatcgcgaccgtctgccggatttcgccgtacgtttcatcgcgttt
cttggcgtgtcgatgcctaacttctggctggcgtttttactggtgatggcgttttcggtg
tatctgcaatggctacccgcgatgggttacggcggctggcagcacatcattttgcctgcg
gtttccattgcctttatgtcgctggcgattaacgcgcgtttactgcgcgccagtatgctg
gacgtcgccggtcagcgtcacgtcacctgggcgcgtctgcgcggcctgaacgacaaacag
accgaacgtcgccacatcctgcgcaatgcctcgctgccgatgatcaccgccgtggggatg
catatcggcgaactgattggcgggacgatgattatcgaaaacatctttgcctggccgggc
gtcgggcgctatgcggtgtcggcgatttttaaccgtgactatccggtgatccagtgcttt
acgctgatgatggtggtggtttttgtggtctgtaatttgattgtcgatttgctcaacgcc
gcgctggacccgcgcattcgtcgtcatgaaggagcgcacgcgtga
              
                            

Download fasta file
RegulonDB