RegulonDB RegulonDB 11.2: Gene Sequence
nikD gene sequence


Size: 765        A: 162  T: 150  G: 233  C: 220

Fasta

 

>nikD E. coli K12. Version NC_000913.3 GI:556503834
atgccgcaacagattgaactacgtaatatcgcgctacaggccgcgcagccgctggtacac
ggtgtatcgttaaccctgcaacgcgggcgcgtgctggcgttagtcggcggtagcggcagc
gggaaatcattaacctgcgccgcaacgctgggcattttgcccgctggcgttcgccagacg
gcgggggaaattttagccgatggcaaaccggtttcgccttgcgccctgcgcggcatcaaa
attgccaccatcatgcagaacccgcgcagcgcctttaatccactgcacaccatgcacacc
cacgcgcgggaaacctgcctggcgttagggaaacccgccgatgacgctacgcttaccgct
gccatagaagcggtggggctggaaaacgccgcgcgcgtgctgaagctgtacccgttcgag
atgagcggcggcatgttgcagcgcatgatgattgcgatggcggtgctgtgtgaatcaccg
tttatcatcgccgatgaaccgaccaccgaccttgacgtggtagcacaggcgcgcatcctc
gatctgctggaaagcattatgcaaaaacaagcgccgggaatgctgctggtgacccatgat
atgggcgttgtggcgcgtctggcggatgacgtggcggtgatgtctgacggtaagattgtc
gaacagggcgatgtagaaacgctgtttaacgcccccaaacatacagtgacgcgcagcctg
gtttccgctcatctcgccctctacggtatggagctggcatcatga
              
                            

Download fasta file
RegulonDB