RegulonDB RegulonDB 10.9: Gene Sequence
nikE gene sequence


Size: 807        A: 189  T: 164  G: 218  C: 236

Fasta

 

>nikE E. coli K12. Version NC_000913.3 GI:556503834
atgactttacttaacatctccggcctttcccatcactatgcgcacggtggatttaacgga
aaacatcaacatcaggcggtgctgaataacgtttccctgaccctgaaaagcggcgaaacc
gtcgccctgctggggcgcagcggctgcgggaaaagtaccctcgcgcggttgctggtgggt
ttagaatcgcccgcgcaggggaatattagctggcgtggcgaaccgctggcgaaactcaat
cgcgcccagcgtaaagcgttccgccgcgatattcagatggtatttcaggactccatcagc
gccgtgaatccgcgcaaaaccgtgcgcgagatcctgcgtgaaccgatgcgccacctgcta
tcactgaaaaaatccgaacaactggcgcgcgccagcgaaatgctgaaggcggtcgatctc
gatgacagcgttctcgacaaacgcccaccgcagttaagcggcggccagctccagcgcgtc
tgcctggctcgcgcgctggcggtcgaaccgaaactactgattctggatgaagccgtttct
aaccttgatctcgtgttacaggcgggtgtcattcgcctgctgaaaaagctacaacaacag
tttggcaccgcctgcctgttcatcacccacgacttacgcctggtagaacgcttttgccag
cgggtaatggttatggacaacggacaaatcgtcgaaacccaggtggtgggagagaaatta
accttttcctctgacgccggacgtgtgctacaaaacgcggtattacccgcattccccgtg
cgccgtcgcaccacagaaaaggtttaa
              
                            

Download fasta file
RegulonDB