RegulonDB RegulonDB 11.0: Gene Sequence
chpB gene sequence


Size: 351        A: 76  T: 86  G: 118  C: 71

Fasta

 

>chpB E. coli K12. Version NC_000913.3 GI:556503834
atggtaaagaaaagtgaatttgaacggggagacattgtgctggttggctttgatccagca
agcggccatgaacagcaaggtgctggtcgacctgcgcttgtgctctccgttcaagccttt
aatcaactgggaatgacgctggtggcccccattacgcagggcggaaattttgcccgttat
gccggatttagcgttcctttacattgcgaagaaggcgatgtgcacggcgtggtgctggtg
aatcaggtgcggatgatggatctacacgcccggctggcaaagcgtattggtctggctgcg
gatgaggtggtggaagaggcgttattacgcttgcaggcggtggtggaataa
              
                            

Download fasta file
RegulonDB