RegulonDB RegulonDB 10.9: Gene Sequence
nlpD gene sequence


Size: 1140        A: 313  T: 229  G: 290  C: 308

Fasta

 

>nlpD E. coli K12. Version NC_000913.3 GI:556503834
atgagcgcgggaagcccaaaattcaccgttcgccgcattgcggctttgtcactggtttcg
ctatggctggcaggctgttctgacacttcaaatccaccggcaccggtcagctccgttaat
ggcaatgcgcctgcaaatactaattctggtatgttgattacgccgccgccgaaaatgggg
acgacgtctacagcgcagcaaccgcaaattcagccggtgcagcagccacaaattcaggct
actcaacaaccgcaaatccagccagtgcagccagtagctcagcagccggtacagatggaa
aacggacgcatcgtctataaccgtcagtatgggaacattccgaaaggcagttatagcggc
agtacctataccgtgaaaaaaggcgacacacttttctatatcgcctggattactggcaac
gatttccgtgaccttgctcagcgcaacaatattcaggcaccatacgcgctgaacgttggt
cagaccttgcaggtgggtaatgcttccggtacgccaatcactggcggaaatgccattacc
caggccgacgcagcagagcaaggagttgtgatcaagcctgcacaaaattccaccgttgct
gttgcgtcgcaaccgacaattacgtattctgagtcttcgggtgaacagagtgctaacaaa
atgttgccgaacaacaagccaactgcgaccacggtcacagcgcctgtaacggtaccaaca
gcaagcacaaccgagccgactgtcagcagtacatcaaccagtacgcctatctccacctgg
cgctggccgactgagggcaaagtgatcgaaacctttggcgcttctgaggggggcaacaag
gggattgatatcgcaggcagcaaaggacaggcaattatcgcgaccgcagatggccgcgtt
gtttatgctggtaacgcgctgcgcggctacggtaatctgattatcatcaaacataatgat
gattacctgagtgcctacgcccataacgacacaatgctggtccgggaacaacaagaagtt
aaggcggggcaaaaaatagcgaccatgggtagcaccggaaccagttcaacacgcttgcat
tttgaaattcgttacaaggggaaatccgtaaacccgctgcgttatttgccgcagcgataa
              
                            

Download fasta file
RegulonDB