RegulonDB RegulonDB 10.10: Gene Sequence
acrR gene sequence


Size: 648        A: 187  T: 167  G: 150  C: 144

Fasta

 

>acrR E. coli K12. Version NC_000913.3 GI:556503834
atggcacgaaaaaccaaacaagaagcgcaagaaacgcgccaacacatcctcgatgtggct
ctacgtcttttctcacagcagggggtatcatccacctcgctgggcgagattgcaaaagca
gctggcgttacgcgcggtgcaatctactggcattttaaagacaagtcggatttgttcagt
gagatctgggaactgtcagaatccaatattggtgaactagagcttgagtatcaggcaaaa
ttccctggcgatccactctcagtattaagagagatattaattcatgttcttgaatccacg
gtgacagaagaacggcgtcgattattgatggagattatattccacaaatgcgaatttgtc
ggagaaatggctgttgtgcaacaggcacaacgtaatctctgtctggaaagttatgaccgt
atagaacaaacgttaaaacattgtattgaagcgaaaatgttgcctgcggatttaatgacg
cgtcgcgcagcaattattatgcgcggctatatttccggcctgatggaaaactggctcttt
gccccgcaatcttttgatcttaaaaaagaagcccgcgattacgttgccatcttactggag
atgtatctcctgtgccccacgcttcgtaatcctgccactaacgaataa
              
                            

Download fasta file
RegulonDB