RegulonDB RegulonDB 10.8: Gene Sequence
rssA gene sequence


Size: 906        A: 216  T: 235  G: 252  C: 203

Fasta

 

>rssA E. coli K12. Version NC_000913.3 GI:556503834
atgagaaagataaaaatagggctggcgctgggatctggcgcggcgagaggttggtcgcat
attggcgttattaatgcgctaaaaaaagtgggtattgaaattgatatcgttgcaggatgt
tcaattggttcgctggtgggcgctgcctatgcatgcgatcgattatctgcgctggaagat
tgggtgacctctttcagttattgggatgttttacgcctgatggatctctcctggcagcgc
ggtgggttactgcgcggcgagcgtgtcttcaatcaataccgcgaaataatgccggaaaca
gagatcgaaaattgttcccgtcgctttgcggctgttgccaccaatttaagtacgggacgt
gaattatggtttactgaaggcgatctccatcttgctattcgcgcatcatgcagtattcca
ggactcatggcacctgttgcacataacggctactggctggttgatggagcagtcgttaac
ccaattcctatttccctcacgcgtgcattgggggctgatattgtgatagcggttgacctg
cagcacgatgctcatttgatgcaacaagatttgctctcctttaatgtcagtgaagaaaat
agcgagaatggtgattctctgccgtggcatgcgcgtctgaaagaaaggttaggcagcata
acgacacgtcgggcggtgacagcgccaacggcaacagagattatgaccacttctatccag
gtgctggagaaccgccttaaaaggaaccgcatggcaggtgatccgcccgatattctgatt
caacctgtttgcccgcaaatatctacgcttgatttccatcgcgcgcacgctgccattgcg
gccggacagctggcagtggaaaggaaaatggacgaacttttgccgttggtacgcaccaac
atttga
              
                            

Download fasta file
RegulonDB