RegulonDB RegulonDB 10.8: Gene Sequence
lrhA gene sequence


Size: 939        A: 223  T: 249  G: 243  C: 224

Fasta

 

>lrhA E. coli K12. Version NC_000913.3 GI:556503834
atgataagtgcaaatcgtccgataattaacctcgacctcgatctgctgagaacatttgtt
gctgttgccgatctgaacacttttgctgccgcagctgccgctgtgtgtcgtactcagtcc
gccgtaagtcagcaaatgcagcgtctggaacaactcgttgggaaagaactgttcgctcgt
cacggtcgcaacaaactgttaactgaacatggcattcaacttcttggttacgccaggaaa
atcctgcgttttaatgatgaggcctgctcatcattaatgttcagtaatcttcagggcgta
ttaactatcggtgcttcagatgaatctgccgatacgatcttacctttcctgttaaatcgc
gtgagttcggtttatccgaaattagcgctggatgtccgcgttaaacgtaatgcctatatg
gcagaaatgctggaatcccaggaagtggatttgatggtaaccacccatcgtccttcagcg
tttaaggcattgaacctgcgtacctcgccaacacactggtactgcgcagcggaatacata
ttgcaaaaaggcgagccgatccctcttgtattgctggatgatcctagcccgtttcgcgat
atggtgctggcgacgcttaataaagcagatattccatggcgactggcttatgtcgcctcg
acgcttccggccgttcgtgcggcagtgaaagccggtcttggcgtgacggcaaggccggtt
gagatgatgagcccggacctgcgtgtgctgagtggagtagatggcttaccgccgctacct
gataccgaatatttgctgtgctatgatccgtccagtaataatgagctggcccaggtgatc
tatcaggcgatggagagctaccataatccgtggcaatacagcccaatgtctgctccggaa
ggggatgattcattgttgattgaaagggatatcgagtaa
              
                            

Download fasta file
RegulonDB