RegulonDB RegulonDB 10.9: Gene Sequence
treB gene sequence


Size: 1422        A: 284  T: 365  G: 401  C: 372

Fasta

 

>treB E. coli K12. Version NC_000913.3 GI:556503834
atgatgagcaaaataaaccaaacggatatcgatcggttgattgaactggtcggcgggcgc
ggcaatattgcgacggtgagccactgtattactcgcctacgctttgtcctcaaccaaccg
gccaatgccagaccgaaagaaattgagcaactccctatggtgaaaggctgtttcaccaat
gccgggcaatttcaggtggtgattggcaccaacgtgggtgattactatcaagcactgatt
gcgtcaaccggacaggcgcaggttgataaagagcaggtaaaaaaagccgcccggcataat
atgaaatggcatgagcagttgatctctcatttcgcggtgatcttcttcccgttgctgccc
gcgttgattagcggcggtttgatcctcggttttcgcaatgtgatcggcgatttgcccatg
agcaacggtcagacgctggcgcaaatgtacccttccctgcaaacgatctacgattttctg
tggttgatcggtgaagcgatcttcttctacctgccggtcggtatttgctggtcagcggtg
aaaaaaatgggcggcacgccgatccttggtatcgtgcttggcgtgacactggtttctcca
cagctgatgaacgcttatctgctcgggcagcagctgccggaagtgtgggactttggcatg
ttcagcatcgccaaagtaggctatcaggcgcaggtgatcccggcactgttagccggactg
gcgctgggcgttattgaaactcgccttaaacgcatcgtgccggattacctctatctggtg
gtggtacccgtctgttcgctgatcctcgcggtgttcctcgcccatgcgctgattggtccg
tttggtcgcatgattggcgatggcgttgcctttgcggtacgtcacctgatgaccggcagc
tttgctccgattggcgcagcattgtttggcttcctgtacgccccgctggtgatcaccggt
gtacaccagaccacgcttgctattgatttgcagatgattcaaagcatgggtggtacgcca
gtgtggccgctgattgcgctgtcgaatatcgctcagggctccgccgtgataggcattatc
atttccagccgcaagcacaatgaacgcgagatctccgtgcctgccgctatctccgcctgg
cttggggtcactgagcctgcaatgtacggcatcaacctgaaatatcgcttcccgatgctg
tgcgcgatgattggttctggtctggcaggattgctatgcggcctgaacggcgttatggcg
aatggcatcggcgtaggcggcctgccgggaattctctcgattcaaccgagctactggcag
gtgtttgcgctggcaatggctatcgccatcatcatcccgattgtactcacctcgtttatc
tatcagcggaaataccgcctgggcacgctggacattgtttaa
              
                            

Download fasta file
RegulonDB