RegulonDB RegulonDB 10.9: Gene Sequence
iscA gene sequence


Size: 324        A: 83  T: 74  G: 99  C: 68

Fasta

 

>iscA E. coli K12. Version NC_000913.3 GI:556503834
atgtcgattacactgagcgacagtgcagcagcgcgagtaaatacctttctggctaaccgc
ggtaaagggtttggcctgcgtctgggcgtgagaacctccgggtgttcaggtatggcttat
gtactggaatttgttgacgaaccgacgccggaagacatcgtgtttgaagacaaaggcgtg
aaagtcgtggtcgatggcaagagcctgcaatttctggacggtacgcagctggacttcgta
aaagaaggcctgaacgaagggtttaaattcaccaacccgaacgtcaaagatgagtgtggt
tgcggcgaaagcttccacgtttga
              
                            

Download fasta file
RegulonDB