RegulonDB RegulonDB 11.0: Gene Sequence
napD gene sequence


Size: 264        A: 71  T: 49  G: 80  C: 64

Fasta

 

>napD E. coli K12. Version NC_000913.3 GI:556503834
atgcacactaactggcaagtttgcagcctggtcgtgcaggccaaaagcgaacgaatttca
gacatcagcacccaactgaacgcctttcccggctgtgaagttgctgtcagcgacgcgccg
agcggtcagttgattgtggtggtggaagcagaagacagcgaaacgctgatccaaaccatt
gagtcagtacgcaacgtagagggcgtgctggcggtgtcgctggtttatcaccagcaggaa
gagcaaggtgaggaaacaccatga
              
                            

Download fasta file
RegulonDB