RegulonDB RegulonDB 10.10: Gene Sequence
galP gene sequence


Size: 1395        A: 286  T: 368  G: 383  C: 358

Fasta

 

>galP E. coli K12. Version NC_000913.3 GI:556503834
atgcctgacgctaaaaaacaggggcggtcaaacaaggcaatgacgtttttcgtctgcttc
cttgccgctctggcgggattactctttggcctggatatcggtgtaattgctggcgcactg
ccgtttattgcagatgaattccagattacttcgcacacgcaagaatgggtcgtaagctcc
atgatgttcggtgcggcagtcggtgcggtgggcagcggctggctctcctttaaactcggg
cgcaaaaagagcctgatgatcggcgcaattttgtttgttgccggttcgctgttctctgcg
gctgcgccaaacgttgaagtactgattctttcccgcgttctactggggctggcggtgggt
gtggcctcttataccgcaccgctgtacctctctgaaattgcgccggaaaaaattcgtggc
agtatgatctcgatgtatcagttgatgatcactatcgggatcctcggtgcttatctttct
gataccgccttcagctacaccggtgcatggcgctggatgctgggtgtgattatcatcccg
gcaattttgctgctgattggtgtcttcttcctgccagacagcccacgttggtttgccgcc
aaacgccgttttgttgatgccgaacgcgtgctgctacgcctgcgtgacaccagcgcggaa
gcgaaacgcgaactggatgaaatccgtgaaagtttgcaggttaaacagagtggctgggcg
ctgtttaaagagaacagcaacttccgccgcgcggtgttccttggcgtactgttgcaggta
atgcagcaattcaccgggatgaacgtcatcatgtattacgcgccgaaaatcttcgaactg
gcgggttataccaacactaccgagcaaatgtgggggaccgtgattgtcggcctgaccaac
gtacttgccacctttatcgcaatcggccttgttgaccgctggggacgtaaaccaacgcta
acgctgggcttcctggtgatggctgctggcatgggcgtactcggtacaatgatgcatatc
ggtattcactctccgtcggcgcagtatttcgccatcgccatgctgctgatgtttattgtc
ggttttgccatgagtgccggtccgctgatttgggtactgtgctccgaaattcagccgctg
aaaggccgcgattttggcatcacctgctccactgccaccaactggattgccaacatgatc
gttggcgcaacgttcctgaccatgctcaacacgctgggtaacgccaacaccttctgggtg
tatgcggctctgaacgtactgtttatcctgctgacattgtggctggtaccggaaaccaaa
cacgtttcgctggaacatattgaacgtaatctgatgaaaggtcgtaaactgcgcgaaata
ggcgctcacgattaa
              
                            

Download fasta file
RegulonDB